Labshake search
Citations for Qiagen :
501 - 550 of 1973 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...
-
bioRxiv - Genetics 2020Quote: ... reverse primers 852Rb-AGGAAGATAGAGAAAGAGCAACC and 852Rc-AGGAAGATAGAAAAGGAGCAACC using QIAGEN One-Step RT-PCR kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5μL of the resulting DNA underwent one or more displacement amplifications using the Repli-G MDA kit (Qiagen), to enrich microbial DNA ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... One hour of tagmentation at 37°C was followed by DNA extraction using MinElute PCR Purification Kit (Qiagen). Extracted DNA was subjected to PCR amplification using unique primers sets (Nextera XT v2 Full set (N7-S5)) ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA extraction was carried out using one of the following methods: 1) QIAmp DNA Mini Kit (Qiagen, Germany); 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... One microgram of genomic DNA was bisulfite converted with the EpiTect® Fast 96 DNA Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and one half of the Moore swab samples was performed using the DNeasy PowerMax Soil Kit (1298810, Qiagen) in accordance with the manufacturer’s protocol with some modifications (25) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of 100 mg/mL RNase (Qiagen) was added ...
-
bioRxiv - Microbiology 2024Quote: ... RNase A (4 µL, 100 mg/mL, Qiagen) was added to remove RNA and incubated at 25°C for 2 min ...
-
bioRxiv - Microbiology 2024Quote: ... after 4 h of coculture (Qiagen, Montreal, Canada). Reverse transcription of isolated RNA was performed using the Maxima First Strand Kit (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... 20 µl RT-PCRs were performed as per the manufacturer’s instructions using the Qiagen One-Step RT-PCR kit (210210, Qiagen) and the following primers ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We extracted DNA from one female (ZW) butterfly per population using Qiagen’s MagAttract HMW DNA extraction kit (Qiagen, inc.) following the manufacture’s suggested protocol ...
-
bioRxiv - Genomics 2020Quote: ... The total RNA solution from 12 wells are passed through one column of RNeasy mini kit (cat.74104, QIAGEN) to obtain approximately 100 g of purified total RNA ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA from Arabidopsis plants was extracted from one month old rosette leaves using RNeasy plant mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription-PCR (RT-PCR) was carried out with total RNA using the one-step RT-PCR kit (QIAGEN) according to the supplier’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and microbial Eukaryotic abundance with a QIAcuity One 5-plex digital PCR (dPCR) instrument (Qiagen Inc. USA, Germantown, MD). dPCR samples represented both the 416 Fire —across SBS ...
-
bioRxiv - Systems Biology 2020Quote: ... the reactions were pooled in sets of four and purified on one column each (MinElute PCR purification kit, Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of RNA from each sample was used for cDNA synthesis by using QuantiTect Reverse Transcription Kit (QIAGEN). Quantitative PCR was performed using SYBR Green PCR Master Mix in QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... After another one-hour incubation bacteria were pelleted and total RNA was extracted using the miRNeasy mini kit (QIAGEN). RNA samples were treated with RNase-Free DNase (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: One-tenth of a TG single cell suspension was used for DNA extraction using the QIAamp DNA Kit (Qiagen). TaqMan qPCR was performed in duplicate on the 7500 Real-Time PCR system using 2X PCR Universal Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... which contained 5 μl of sort buffer consisting of (1X Qiagen One-step RT PCR Buffer (Qiagen, Hilden, Germany), 0.1 mM dithiothreitol (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: Total DNA was extracted from muscle tissue of one male fish using a QIAamp DNA Blood Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Systems Biology 2022Quote: ... genomic DNA was extracted for pelleted cell fractions with one of the following: DNeasy Blood & Tissue Kit (Qiagen #69504) for fractions with fewer than 5 x 106 cells ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated one week after the initial passage using Trizol/Chloroform extraction and RNeasy Mini kit (Qiagen) purification ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV2 subgenomic viral RNA was quantified using primer probe sets as previously described (Wölfel et al., 2020) and Quantifast One-Step RT-PCR master mix (Qiagen) on a QuantStudio 3 or 5 instrument (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Biophysics 2022Quote: ... HEK-293 cells were seeded in Labtek chambers (#1.5 glass-bottom) one day in advance and then transfected with Effectene Transfection Reagent (QIAGEN) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... One hundred microliters of supernatant was used for RNA extraction using the QIAamp® Viral RNA Mini kit (QIAGEN). Sample was treated with DNAse according to manufacturer recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Allele-specific expression was measured using RT-ddPCR with the One-Step RT-ddPCR Advanced Kit for Probes (Qiagen) on a QX200 ddPCR Droplet Reader (BioRad ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were stored at room temperature in one mL of cell lysis buffer (Gentra Puregene Kit, Qiagen, USA) until further analysis for molecular sexing (following Griffiths et al. ...
-
bioRxiv - Microbiology 2024Quote: ... were quantitated using one-step qRT-PCR with 2µl of RNA input was conducted using the QuantiNova Probe RT-PCR kit (Qiagen) according to the manufacturer’s instructions and run on a QuantStudio 6 instrument (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells debris was pelleted by centrifugation at 17,000 × g for one hour and the supernatant loaded onto a 10-ml Ni2+-NTA column (Qiagen). The column was washed with 1 L buffer A and the protein batch eluted with 100 ml buffer B (buffer B = buffer A supplemented with 290 mM imidazole) ...
-
bioRxiv - Immunology 2024Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Cancer Biology 2022Quote: ... paraffin-embedded (FFPE) 4 × 4 μm tissue sections of primary tumors and matched brain metastases using RNeasy FFPE kit (Qiagen, Hilden, Germany) per manufacturers’ instructions ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...