Labshake search
Citations for Qiagen :
451 - 500 of 1973 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... which were merged into one assembly using CLC-Bio Genomics Workbench De Novo Assembly (Qiagen, v11.0.1) with default parameters ...
-
bioRxiv - Genomics 2023Quote: ... and the BioSprint 96 one-for-all Vet Kit utilizing ASL buffer (19082; Qiagen, Germantown, MD) and bead beating ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary neurons were harvested one week later on DIV19 after which RNA was extracted (RNeasy, QIAGEN) and submitted to the Genomics core lab at the Heflin Center for Genomic Sciences at the University of Alabama at Birmingham for library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... One µg of RNA was used to generate cDNA with QuantiTect Reverse Transcription kit (Qiagen #205313). For the RT-PCR reaction ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... at 56°C for one hour then were homogenized using tungsten beads and a TissueLyser (Qiagen) for one minute at 30 cycles/sec ...
-
bioRxiv - Genomics 2024Quote: ... The assay was performed in a dPCR thermal cycler (QIAcuity One, 5plex Device, Qiagen, Hilden Germany) in a 96-well nanoplate with 8.500 nanowells for each sample (QIAcuity Nanoplate 8.5k 96-well ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Genetics 2024Quote: ... 4 µL RNase (QIAGEN, Venlo, The Netherlands) was added ...
-
bioRxiv - Immunology 2024Quote: ... containing 4 IU/ul DNAseI (Qiagen, 79254) and 1 IU/ul RNAseq inhibitor (Recombinant RNAsin ...
-
bioRxiv - Cell Biology 2024Quote: ... with 4 µg/mL DNase (79254, Qiagen) at 37 °C for 15-20 min ...
-
bioRxiv - Physiology 2020Quote: ... mixed with one volume of 70% ethanol and applied directly to an RNeasy Mini Kit column (Qiagen). DNAse treatment on the column and total RNA recovery were performed as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: One µg of DNA was bisulfite-treated using the EpiTect® 96 Bisulfite Kit (Qiagen, Hilden, Germany) and analysed using the Infinium Human Methylation 450K BeadChips (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Viral genomic RNA (gRNA) was detected with a one-step real-time RT-PCR assay (Quantifast, Qiagen) using primers and probes generated to target either the SARS-CoV-2 E (28 ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-PCR was carried out using the QuantiTect probe RT-PCR kit (Qiagen, Valencia, CA) with 500 nM forward and reverse primers and 50 nM labeled probes (DENV2-FAM and ZIKV-FAM and PGK1-VIC TaqMan) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from one-week-old Arabidopsis seedlings using the RNeasy Plant Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... One third of specimens were extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA), while later extractions used a CTAB/PCI extraction approach (Chen et al. ...
-
bioRxiv - Genomics 2022Quote: ... bacterial pellets were pooled into one tube and DNA extracted with the Gentra Puregene tissue kit (Qiagen) with resuspension of the DNA pellet in 100 µl of nuclease-free water.
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of RNA was reverse transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen). The template amount of 6.6 ng RNA equivalent per wellt was used and the PCR reaction was performed in triplicate using the total volume of 8 µl in 384 well plate format ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA were extracted from approximately one million to two million cells using RNeasy Mini Kit (QIAGEN) according to the recommendation of manufacturer and then NEBNext® Poly (A ...
-
bioRxiv - Microbiology 2021Quote: ... RORC1 and RORC2 gene expression was evaluated by One step SYBR green real-rime RT-PCR (Qiagen) using a Light-Cycler 480 II as follows ...
-
bioRxiv - Genomics 2021Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (QIAGEN, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... One section was added to a MACs M tube (Miltenyi Biotech, U.K.) containing 1ml Qiazol (Qiagen, U.K.) and dissociated on a GentleMACs (Miltenyi Biotech ...
-
bioRxiv - Immunology 2020Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR Kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT Mix ...
-
bioRxiv - Immunology 2020Quote: ... Extraction of these samples was performed using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... or 500 ng of total RNA for reverse transcription using the One Step RT PCR-Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT mix ...
-
bioRxiv - Neuroscience 2023Quote: ... VG and DRG were transferred into an 1.5ml tube containing one Tungsten Carbide bead (3mm, Qiagen, #69997) and 1 mL of Qiazol lysis reagent (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: RNA was isolated from one quarter of a mouse kidney using RNeasy Plus Mini Kit (Qiagen, 74134). For quantitative real-time PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from one haploid male at emergence using the MagAttract® HMW DNA Kit (Qiagen). The male wasp tissues were disrupted in a 2 mL tube containing 200 µL of 1X DPBS ...
-
bioRxiv - Zoology 2023Quote: Genomic DNA was extracted from one specimen using the Dneasy Blood & Tissue kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions but with the initial proteinase K lysis step extended to 16 hours at 56°C with continuous agitation.
-
bioRxiv - Microbiology 2023Quote: ... with extraction performed as is the protocol for the BioSprint 96 One-For-All Vet Kit (Qiagen). Every eleventh of twelve wells in a 96-well plate was a blank DNA extraction control (seven in total ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted from BC and NS using Biosprint 96 One-for-all vet Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from cell pellets using the BioSprint 96 One-For-All Vet processing kit (Qiagen) according to instructions with the following modifications ...
-
Microbial iCLIP2: Enhanced mapping of RNA-Protein interaction by promoting protein and RNA stabilitybioRxiv - Molecular Biology 2024Quote: ... one steel bead (5 mm diameter) was added and placed into a pre-cooled TissueLyser Adapter (Qiagen). The samples underwent two rounds of cell lysis ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was first extracted from one million cells using the RNeasy Mini Kit (cat. no. 74004, Qiagen) using an on-column DNase digestion (cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram of mRNA was reverse transcribed into cDNA by using an QuantiTect Reverse Transcription Kit (QIAGEN), according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Genomics 2022Quote: ... After overnight proteinase K digestion in Lysis Buffer (Bionano Genomics) and one hour treatment with RNAse A (Qiagen), plugs were washed four times in 1x Wash Buffer (Bionano Genomics ...
-
bioRxiv - Cell Biology 2021Quote: One µg of total RNA extracted from ELT3-V cells with the RNeasy Mini Kit (Qiagen, Germantown, MD) was reverse-transcribed into cDNA using amfiRivert cDNA Synthesis Master Mix (GenDEPOT ...
-
bioRxiv - Plant Biology 2021Quote: ... Sets of 95 ligations were pooled into one sample and purified using QIAquick PCR Purification Kit (Qiagen, Germany). The pooled ligation mixtures (5 μL ...
-
bioRxiv - Microbiology 2022Quote: ... the bacterial assemblage genomic DNA was extracted from one g of beads using DNeasy PowerSoil Pro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... complementary DNA strand was synthesized from one μg of total RNA using QuantiTect® reverse transcription kit (Qiagen). Quantitative RT-PCR gene amplification was carried out using the CFX-96 thermocycler (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: The quantitative real-time TaqMan based assay was carried out using a One-step RT-PCR kit (Qiagen) in the Light Cycler 2.0 system (Roche) ...
-
bioRxiv - Genetics 2021Quote: Long PCR products were purified by gel electrophoresis and short ones with the QIAquick PCR purification kit (Qiagen). Terminal adenine overhangs were added using Taq polymerase in the presence of dATP ...