Labshake search
Citations for TriLink BioTechnologies :
101 - 150 of 501 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... with complete substitution of uridine to 1- methylpseudouridine and CleanCap AG analog (N-1081 and N-7113, TriLink Biotechnologies).
-
bioRxiv - Immunology 2023Quote: ... an anti-reverse capping analogue (Trilink Biotechnologies, San Diego, CA, USA), N1-methylpseudouridine (Sapala Organics Private Limited ...
-
bioRxiv - Immunology 2023Quote: ... Animals were mock-immunized with the CpG oligonucleotide (5’-TCGTCGTTGTCGTTTTGTCGTT-3’) (Trilink Inc., Santa Fe Springs, CA) using 100 μg CpG/guinea pig and 150μg alum (Alhydrogel ...
-
bioRxiv - Molecular Biology 2023Quote: Pin-point system (nCas9-UGU-UGI and rAPOBEC1-MCP) and SpCas9 mRNAs were produced commercially (Trilink Biotechnologies and Horizon DiscoveryTM) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 mM N1-Methylpseudouridine-5’-triphosphate (Trilink, N-1081) was substituted for the standard uridine triphosphate included in the HiScribe Kit for certain reactions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... along with 500 ng of linear template and 4 mM CleanCap AG Reagent (Trilink, N-7113). 5 mM N1-Methylpseudouridine-5’-triphosphate (Trilink ...
-
bioRxiv - Biochemistry 2023Quote: ... or EGFP-mRNA (TriLink BioTechnologies) in 10 mM sodium citrate buffer (pH 4.0 ...
-
bioRxiv - Cancer Biology 2023Quote: The long strand of the AsiC synthesized with 2′-fluoropyrimidines was annealed to the short antisense strand (TriLink Biotechnologies) with a 2-fold molar excess of the short strand ...
-
bioRxiv - Bioengineering 2023Quote: ... was mixed with an aqueous phase (50 mM citrate buffer, pH 4) containing Luciferase mRNA that was either purchased by TriLink (most experiments) or made in-house via in vitro transcription (IVT)40 at a flow rate ratio of 1:3 and at a total lipid/mRNA weight ratio of 40:1 in a microfluidic mixing device (NanoAssemblr Ignite ...
-
bioRxiv - Microbiology 2023Quote: ... and ARCA CAP (TriLink Biotechnologies). The fidelity of transcripts was assessed and normalized by agarose gel electrophoresis.
-
bioRxiv - Immunology 2023Quote: ... luciferase mRNA (TriLink) was used to measure translational regulation by nigericin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... m1Ψ-5′-triphosphate (TriLink) was incorporated instead of UTP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cas13a sgRNAs were designed to target CleanCap EGFP and mCherry mRNAs (5moU, TriLink Biotechnologies, San Diego, CA). The targeting sgRNAs used in this study were OCT4 sgRNA1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the CleanTag Small RNA Library Kit (TriLink Biotechnologies, San Diego, CA). Single-end 75x sequencing was performed using the NextSeq 500 platform (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... and Cas9 mRNA (25 ng/μL, TriLink) were co-injected into zygotes (F1 hybrids between strains FVB/NJ and B6(Cg)-Tyrc-2J/J ...
-
bioRxiv - Biochemistry 2023Quote: ... The following NTPs were obtained from Trilink Biotechnologies with the reported purities in parentheses m4C (>90%) ...
-
bioRxiv - Biophysics 2023Quote: ... we replace the non-fluorescent UTP in the transcription reaction with ΨTP (TriLink BioTechnologies).
-
bioRxiv - Cancer Biology 2023Quote: ... the Zbtb46 ORF sequence “ATGAACAACCGAAAGGAAGATATGGAAATCACTTCTCACTACCGGCATCTGCTTC GAGAGCTCAATGAGCAGAGGCAGCACGGAGTCCTCTGTGATGCGTGCGTCGTGG TGGAGGGCAAGGTCTTCAAGGCACATAAGAACGTCTTGCTTGGGAGCAGCCGCTA CTTTAAGACGCTCTACTGCCAGGTACAGAAGACATCTGACCAGGCCACCGTCACT CACTTGGACATTGTTACAGCCCAGGGCTTCAAGGCCATTATTGACTTCATGTACTC CGCCCATCTGGCTCTCACTAGTAGGAATGTCATCGAGGTGATGTCAGCTGCCAGC TTCCTACAGATGACTGACATTGTGCAGGCCTGCCATGATTTCATCAAGGCTGCACT GGACATCAGCATAAAGTCAGATGCCTCCGATGAACTCTCAGAATTTGAGATTGGCA CCCCAGCCAGCAACAGTACAGAGGCGTTGATCTCAGCTGTGATGGCTGGAAGGAG TATCTCCCCATGGTTGGCTCGGAGAACAAGTCCTGCCAATTCTTCTGGAGACTCTG CCATTGCCAGCTGTCATGAAGGAGGAAGCAGCTATGGGAAGGAGGACCAGGAAC CCAAAGCTGATGGCCCTGATGACGTTTCTTCACAGTCTTTGTGGCCTGGAGATGTA GGCTATGGGTCTCTGCGCATCAAGGAAGAACAGATTTCACCATCACATTATGGAGG GAGTGAGCTTCCATCTTCCAAGGACACTGCAATACAGAATTCTTTATCAGAACAGG GTTCTGGGGATGGCTGGCAGCCCACAGGCCGGAGGAAGAATCGGAAAAACAAAG AGACTGTCCGACACATCACCCAGCAGGTGGAGGAGGACAGCCAGGCTGGCTCTC CAGTACCTTCATTCCTACCCACATCGGGATGGCCTTTCAGCAGCCGAGACTCAAAT GTAGACCTGACGGTCACTGAGGCCAGCAGCTTGGACAGCCGAGGCGAGAGAGCA GAGCTCTATGCTCACATCGATGAGGGCCTACTAGGAGGAGAAACCAGCTACTTGG GCCCACCCCTCACCCCAGAGAAGGAAGAAGCACTACACCAGGCTACTGCAGTGG CCAATCTTCGTGCTGCACTCATGAGTAAGAACAGTCTGCTGTCACTCAAGGCTGAC GTGCTCGGTGATGATGGCTCACTTCTGTTCGAGTACCTGCCCAAAGGTGCCCACT CACTGTCTCGTAAGTGCAAGTTCTGGTGTGTCACTGTGTCTTCCTTTGGTTTAAGCA CCTCAGTTCAGCCCTTCAGACCCTGGAGTCACTGA” was made into a modified mRNA transcript with complete substitution of pseudo-U in RNase-free water from TriLink Biotechnologies ...
-
bioRxiv - Bioengineering 2023Quote: There were two sources for the mRNA used in this study: 1) commercial synthesis by TriLink Biotechnologies (TriLink mRNA was used in Fig ...
-
bioRxiv - Bioengineering 2023Quote: ... CleanCap-Enhanced Green Fluorescent Protein mRNA was purchased from TriLink Biotechnologies ...
-
bioRxiv - Bioengineering 2023Quote: ... commercial synthesis by TriLink Biotechnologies (TriLink mRNA was used in Fig ...
-
bioRxiv - Bioengineering 2023Quote: ... In vitro transcription (IVT) was performed by TriLink Biotechnologies to synthesize mRNA encoding CAR-CD19.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated using the CleanTag Small RNA Library Prep Kit (TriLink Biotechnologies). Sequencing was performed on the HiSeq3000 platform (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... These sgRNAs (20 ng/μl each) and Cas9 mRNA (50 ng/ μl, purchased from Trilink Biotechnologies) were co-microinjected into the cytoplasm of zygotes collected from C57BL/6N mice (Charles River Laboratories) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNAs (20ng/ul each) were co-microinjected with Cas9 mRNA (50 ng/ul, purchased from Trilink Biotechnologies) into the cytoplasm of zygotes collected from B6D2F/J F1 hybrid mice (JAX Stock No ...
-
bioRxiv - Cancer Biology 2023Quote: Synthetic mRNA encoding for full-length model antigen (i.e., CleanCap GFP, catalog L-7601 and CleanCap ovalbumin, OVA, catalog L-7610) were purchased from TriLink Biotechnologies (San Diego ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at ∼70% confluency and reverse transfected with indicated concentrations of mRNA-Cas9-HA containing 5-methoxyuridine (5moU) or mRNA-eGFP 5moU (TriLink) in MessengerMAX (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... The RNA was further 3’-end-labeled with azide-dUTP (TriLink biotechnologies) using yeast poly(A ...
-
bioRxiv - Genetics 2023Quote: ... and Cas9 Nickase mRNA (Trilink; 100 ng/μl) in injection buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions testing IRES nLuc reporters were additionally supplemented with 50 ng/µL (final) competitor FFLuc mRNA (TriLink Biotechnologies # L-7602-100) to increase the fidelity of the IRES nLuc signal ...
-
bioRxiv - Immunology 2023Quote: ... The adjuvanted microsphere vaccine formulation contained 3 µg/mg of survivin-specific class 1 and class 2 peptides and 0.5 µg/mg of the TLR-9 oligonucleotide agonist CpG (ODN-1018) (Trilink Biosciences, San Diego, CA, USA). The microspheres ...
-
bioRxiv - Cell Biology 2023Quote: ... s4UTP (TriLink, tebu-bio GmbH ...
-
Evaluation of mRNA-LNP and adjuvanted protein SARS-CoV-2 vaccines in a maternal antibody mouse modelbioRxiv - Immunology 2023Quote: ... CleanCap (TriLink), then cellulose purified as previously described.17 m1Ψ-containing mRNAs were encapsulated in lipid nanoparticles (LNP ...
-
Evaluation of mRNA-LNP and adjuvanted protein SARS-CoV-2 vaccines in a maternal antibody mouse modelbioRxiv - Immunology 2023Quote: ... diproline-modified spike protein from the SARS-CoV-2 Wuhan-Hu-1 strain were produced as previously described15,16 with m1Ψ-5-triphosphate (TriLink) instead of UTP and capped cotranscriptionally using the trinucleotide cap1 analog ...
-
bioRxiv - Genetics 2023Quote: ... The sgRNA (20 ng/ul) and donor oligonucleotides (100 ng/ul) were co-microinjected with Cas9 mRNA (20ng/ul, purchased from Trilink Biotechnologies) into the cytoplasm of zygotes collected from C57BL/6N mice (Charles River Laboratory) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) and 2’-deoxy-P-nucleoside-5’-triphosphate (dPTP) (TriLink). For each library ...
-
bioRxiv - Genomics 2023Quote: ... One-cell staged wild-type zebrafish embryos were removed from their chorion and injected with 1nL of a solution containing 20mM 4sUTP (TriLink Biotechnologies), 30ng/uL GFP mRNA ...
-
bioRxiv - Biophysics 2023Quote: ... and dinucleotides (Trilink, Biolog LSI GmbH) were diluted in nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2023Quote: Reagents to prepare Cap0- and Cap1-modified Renilla Luciferase (RLuc) mRNA using the CleanCap technology (Trilink)were provided as part of a cooperation with Trilink Bioscience ...
-
bioRxiv - Bioengineering 2023Quote: ... and m1Ψ-5’-triphosphate (Trilink biotechnologies) instead of uridine bases ...
-
bioRxiv - Bioengineering 2023Quote: ... and m1Ψ-modified spike mRNA with di-proline substitutions of K968 and V969 were obtained from Trilink biotechnologies (San Diego ...
-
bioRxiv - Bioengineering 2023Quote: ... synthesis of mRNA was carried out using MEGAscript™ T7 Transcription Kit (Waltham, MA, USA) with the addition of ACRA 5’ cap (Trilink biotechnologies) and m1Ψ-5’-triphosphate (Trilink biotechnologies ...
-
bioRxiv - Biophysics 2023Quote: ... and 100 µM GpA dinucleotides (TriLink) were added to the solution and incubated for additional 10 min at 37°C to allow the ternary complex to initiat transcription and stall at the first G in the template ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or ddGTP (Trilink Biotechnologies), 3.25 µL RNase-free water (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... mRNAs were modified with N1-Methyl-pseudouridine (Synthgene) and capped using CleanCap Reagent (TriLink). After this ...
-
bioRxiv - Systems Biology 2023Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Immunology 2023Quote: ... T cells were electroporated with Cas9 mRNA (Trilink) and expanded inn 10U human IL-2 in X-VIVO-15 media for 10 additional days ...
-
bioRxiv - Biochemistry 2023Quote: ... Cre recombinase mRNA (TriLink BioTechnologies) or EGFP-mRNA (TriLink BioTechnologies ...
-
bioRxiv - Bioengineering 2023Quote: ... 1.5 µL of 20 ng/µL Hpd-targeting sgRNA (Trilink Biotechnologies), and 4.9 µL of 61 µM SpCas9 V3 (Integrated DNA Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... a spike-in mRNA standard was added at this step (CleanCap EGFP mRNA from TriLink, L-7601) to account for RNA loss during processing ...