Labshake search
Citations for TriLink BioTechnologies :
51 - 100 of 533 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... fully substituting UTP with N1-methylpseudouridine-5’-phosphate (TriLink Biotechnologies) and co-transcriptionally capping with CleanCap Reagent AG (TriLink Biotechnologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... or CleanCap® Reagent AG (3’OMe) (CAT#: N-7413, TriLink Biotechnology) analog was added.
-
bioRxiv - Molecular Biology 2024Quote: ... an additional 10 mM of CleanCap® Reagent AU (CAT#: N-7114, TriLink Biotechnology) or CleanCap® Reagent AG (3’OMe ...
-
bioRxiv - Molecular Biology 2024Quote: To generate hTERT RPE-1 MLH1-/- cell lines, a sgRNA (Synthego, MLH1ex12: ATTTAACCATCTCCCCAGAG, 100 pmol) and Cas9 mRNA (TriLink, L-7206) were transfected into parental cell lines and inactivation was confirmed in clonal populations via Sanger sequencing (MLH1ex12_PCR_Forward ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM CleanCap® AG reagent (TriLink® BioTechnologies, TRN7113), transcription buffer (40 mM Tris·HCl pH 8.0 ...
-
bioRxiv - Bioengineering 2024Quote: ... In vitro transcription was performed with complete substitution of uridine with N1-methylpseudouridine (Trilink Biotechnologies, N-1081). All transcripts were purified by silica-column chromatography followed by cellulose purification to remove dsRNA impurities.44 The presence of dsRNA impurities was determined by dot blot (500 ng/dot ...
-
bioRxiv - Bioengineering 2024Quote: ... eGFP mRNA was purchased from TriLink Biotechnologies (catalog # ...
-
bioRxiv - Biochemistry 2024Quote: ... 1.0 mM dDAP-TP (TriLink Biotechnologies, N-2004), 1.0 mM ddATP-11-biotin (Revvity ...
-
bioRxiv - Biochemistry 2024Quote: ... Fluc mRNA (Trilink L-7602), and IVISbrite D-Luciferin potassium salt (PerkinElmer cat ...
-
bioRxiv - Microbiology 2024Quote: ... Differentiation to hemogenic endothelium (starting at “Day 0”) was initiated via ETV2 mRNA (TriLink Biotechnologies) transfection in TeSR-E8 media (STEMCELL Technologies ...
-
bioRxiv - Immunology 2024Quote: ... mRNA was produced using T7 RNA polymerase after completely linearization and capped co-transcriptionally with a trinucleotide cap-1 analog (TriLink) via the Hi Scribe T7 Clean Cap NEB kit ...
-
bioRxiv - Immunology 2024Quote: ... In vitro transcription of the Influenza HA saRNA construct derived from TC-83 was performed by Trilink (San Diego, USA) using 5-Methylcytosine (5mC ...
-
bioRxiv - Immunology 2024Quote: ... were carried out with natural nucleosides and co-transcriptional capping with CleanCap AU (Trilink, N-7114). RNA was purified with silica membrane spin columns (NEB ...
-
bioRxiv - Immunology 2024Quote: ... Unmodified (L-7602) and 5moU-modified (L-7202) fLuc-encoding mRNA was obtained from Trilink (San Diego, USA).
-
bioRxiv - Immunology 2024Quote: ... USA) with natural nucleosides and co-transcriptional capping with CleanCap AU (Trilink, N-7114). In vitro transcription of the Influenza HA saRNA construct derived from TC-83 was performed by Trilink (San Diego ...
-
bioRxiv - Immunology 2024Quote: ... noncoding filler mRNA were synthesized by Trilink (San Diego, USA). Unmodified (L-7602 ...
-
bioRxiv - Immunology 2024Quote: ... USA) using 5-Methylcytosine (5mC) and co-transcriptional capping with CleanCap AU (Trilink, N-7114). N1-Methylpseudouridine-5’-Triphosphate-modified ...
-
bioRxiv - Immunology 2024Quote: ... The adjuvants CpG-1826 (TriLink, San Diego ...
-
bioRxiv - Immunology 2024Quote: ... The adjuvants CpG-1826 (TriLink, San Diego ...
-
bioRxiv - Bioengineering 2024Quote: ... Firefly luciferase mRNA was purchased from TriLink Biotechnologies (San Diego ...
-
bioRxiv - Synthetic Biology 2024Quote: N1-methylpseudouridine-5’-Triphosphate (TriLink Biotechnologies ...
-
bioRxiv - Synthetic Biology 2024Quote: CleanCap Reagent AG (3’ OMe) (TriLink Biotechnologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... The GTP nucleotide solution was used at a final concentration of 3.0 mM instead of 7.5 mM and the anti-reverse cap analog N7-Methyl-3’-O-Methyl-Guanosine-5’-Triphosphate- 5’-Guanosine (ARCA, Trilink) was used at a final concentration of 12.0 mM resulting in a final ratio of Cap:GTP of 4:1 that allows efficient capping of the mRNA ...
-
bioRxiv - Genomics 2024Quote: ... 5-Carboxy-dCTP (TriLink, Catalog no. N-2063), 5-Hydroxymethyl-dCTP (Jena Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... consisting of 15-20 cycles with mutagenic nucleotides 8-oxo-dGTP and dPTP (TriLink O-0111, N-2037). The pCTCON2 system primers used were forward ...
-
bioRxiv - Immunology 2024Quote: ... co-transcriptionally capped using the 3’OMe CleanCap™ system (TriLink Biotechnologies) and purified using a modified cellulose base chromatography method (34) ...
-
bioRxiv - Immunology 2024Quote: ... CleanCap reagent AG (TriLink) was used in accordance with the manufacturer’s recommendations to produce Cap1 chemistry at the 5’ terminus ...
-
bioRxiv - Immunology 2024Quote: ... Hyperactive Tc BusterTM mRNA (1 μg, TriLink Biotechnologies or Aldevron) and nanoplasmid DNA encoding an αCD19 CAR (1 μg ...
-
bioRxiv - Immunology 2024Quote: ... ABE8e Base Editor mRNA (1.5 μg, TriLink) and target gRNAs (1 μg ...
-
bioRxiv - Immunology 2024Quote: ... mRNA encoding codon optimised SpCas9 or codon optimised BE3 (coBE3) was supplied by TriLink BioTechnologies (San Diego ...
-
bioRxiv - Immunology 2024Quote: ... 0.6mM dGTP and 0.2mM biotin-16-aminoallyl-2’-dUTP (TriLink BIoTechnologies, Cat No. N-5001). The reaction was first incubated at 95°C for 2 minutes and ramped down to 4°C at a rate of 0.1°C/s ...
-
bioRxiv - Immunology 2024Quote: ... N1-methylpseudouridine-5’-triphosphate (m1Ψ-5′-triphosphate) (TriLink #N-1081) instead of uridine-5’-triphosphate (UTP ...
-
bioRxiv - Immunology 2024Quote: ... and Rpk9-I53-50A mRNA was performed by TriLink Biotechnologies using previously described standard protocols69,116 ...
-
bioRxiv - Immunology 2024Quote: ... N1-methylpseudouridine-5’-triphosphate (m1Ψ-5′-triphosphate) (TriLink #N-1081) instead of uridine-5’-triphosphate (UTP) ...
-
bioRxiv - Immunology 2024Quote: ... and the CleanCap Reagent AG (TriLink #N-7113) for co-transcriptional capping.
-
bioRxiv - Immunology 2024Quote: Ovalbumin (Ova) mRNA with 5’ methoxy-uridine (5moU) base modification (Trilink BioTechnologies, USA) was formulated into lipid nanoparticles by Integrated Nanotherapeutics (Canada ...
-
bioRxiv - Immunology 2024Quote: ... Up to 5E6 cells were then resuspended in 100 μl Opti-MEM and electroporated with 10 μg CleanCap™ Cas9 mRNA (TriLink, Cat-no. L-7206). On day –5 ...
-
bioRxiv - Molecular Biology 2024Quote: Chemically modified GFP mRNA (cat. # L-7201) and Cas9 mRNA (cat. # L-7206) were purchased from TriLink. Chemically modified sgRNAs were ordered from IDT ...
-
bioRxiv - Molecular Biology 2024Quote: ... or N1-Methylpseudouridine-5’-Triphosphate (TriLink Biotechnologies), or CTP was fully substituted with 5-methylcytidine-5’-triphosphate (TriLink Biotechnologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... or CTP was fully substituted with 5-methylcytidine-5’-triphosphate (TriLink Biotechnologies) in the in vitro transcription reactions ...
-
bioRxiv - Molecular Biology 2024Quote: ... UTP was fully substituted with either pseudouridine-5’-triphosphate (TriLink Biotechnologies) or N1-Methylpseudouridine-5’-Triphosphate (TriLink Biotechnologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... in the presence of CleanCap® Reagent AU (TriLink Biotechnologies). For modified RNAs ...
-
bioRxiv - Molecular Biology 2024Quote: ... N1-Methylpseudouridine-5’-Triphosphate (Trilink, N-1081), 5-Methoxyuridine-5’- Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5-Methoxyuridine-5’- Triphosphate (Trilink, N-1093), 5-Methylcytidine-5’-Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pseudouridine-5’-Triphosphate (Trilink, N- 1019), N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5-Methylcytidine-5’-Triphosphate (Trilink, N-1014). Following the in vitro transcription ...
-
bioRxiv - Molecular Biology 2024Quote: ... CleanCap Reagent AG (Trilink, N-7113), Pseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Molecular Biology 2024Quote: ... Capping was carried out co-transcriptionally using the CleanCap Reagent AG (3′ Ome) (N-7413, TriLink) and the Yeast Inorganic Pyrophosphatase (Cat ...
-
bioRxiv - Cell Biology 2024Quote: The mDrp1-KI mice were generated using Cas9 mRNA (TriLink Bio, L6125100), sgRNA and single-strand DNA homology-directed repair (HDR ...
-
bioRxiv - Physiology 2024Quote: ... These two sgRNAs (20 ng/ul each) were co-microinjected with Cas9 mRNA (50 ng/ul, TriLink BioTechnologies) into the cytoplasm of zygotes collected from ChR2-EYFP mouse mating pairs ...