Labshake search
Citations for TriLink BioTechnologies :
1 - 50 of 501 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: tC°-tCnitro –labeled DNA samples (see Supplementary Figure S1) were purchased from TriLink Biotechnologies and prepared as described in SI Methods 1.1 ...
-
bioRxiv - Systems Biology 2024Quote: ... co-transcriptionally capped with CleanCap Reagent AG (TriLink N-7113), treated with TURBO DNase (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... the T7 promoter sequence was changed to GCTAATACGACTCACTATAAGG and CleanCap AG (TriLink N-7113) was added to the in vitro transcription reaction according to manufacturer protocols.
-
bioRxiv - Systems Biology 2024Quote: ... N1-methylpseudouridine substituted RNAs were produced by the complete replacement of uridine triphosphate in the T7 transcription reaction with N1-methylpseudouridine triphosphate (Trilink N-1081). Uridine and N1-methylpseudouridine RNAs were then mixed in equimolar ratios prior to in vitro translation.
-
bioRxiv - Molecular Biology 2024Quote: ... the unique DNA barcodes were directly conjugated to the antigen using a SoluLINK Protein-Oligonucleotide Conjugation kit (TriLink, S-9011) according to kit protocol ...
-
bioRxiv - Genomics 2024Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Genomics 2024Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
A nascent riboswitch helix orchestrates robust transcriptional regulation through signal integrationbioRxiv - Molecular Biology 2024Quote: ... 10 µM ApU dinucleotide primer (Trilink), and 50 nM DNA template ...
-
bioRxiv - Cancer Biology 2024Quote: ... and either 7.5 mM GTP or 6.75 mM 7-deazaguanine (TriLink N-1044) plus 0.75 mM GTP was used ...
-
bioRxiv - Developmental Biology 2024Quote: ... mCherry and Cre-recombinase were used (Trilink Biotechnologies). Encapsulation of modified mRNAs for intracameral injection was performed using Lipofectamine Messenger Max transfection reagent (Thermo Fischer ...
-
bioRxiv - Developmental Biology 2024Quote: ... These reagents included the Bxb1 mRNA (Trilink) at 100ng/µl ...
-
bioRxiv - Immunology 2024Quote: ... Methyl-pseudouridine (SYNTHGENE)-modified mRNAs were capped using Cap1 Analogue Reagent (TriLink) and further purified by Monarch RNA purification columns (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... transduced activation reporter cells were enriched by puromycin selection (1µg mL-1) following nucleofection of dCas9-VPR mRNA (TriLink) and a Cas9 sgRNA targeting the ESR protospacer (IDT) ...
-
bioRxiv - Genetics 2024Quote: ... Cas9 mRNA was purchased from TriLink BioTechnologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of Cas9 mRNA (50 ng/ µl, #L-6125, TriLink Biotechnologies) and two specific gRNAs (25 ng/ µl each ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng CleanCap Cas9 (5moU) mRNA (Trilink, L-7206) was electroporated into the cells using the Neon™ Transfection System (ThermoFisher) ...
-
bioRxiv - Genetics 2024Quote: ... and Cas9 Nickase mRNA (Trilink; 100 ng/μl) in injection buffer ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM ATP or a modified ATP analog (Trilink, 2’-O-Methyladenosine-5’-Triphosphate ...
-
bioRxiv - Immunology 2024Quote: ... Modified mRNA transcript with full substitution of Pseudo-U was synthesized by TriLink Biotechnologies using proprietary CleanCap® technology ...
-
bioRxiv - Immunology 2024Quote: ... Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies) to generate a natural Cap 1 structure ...
-
bioRxiv - Immunology 2024Quote: ... 3 μl T7 RNA polymerase (Biolabmix) and 10xBuffer (TriLink), 4 mM trinucleotide cap 1 analog ((3′-OMe-m7G)-5′-ppp-5′-(2′-OMeA)pG ...
-
bioRxiv - Bioengineering 2024Quote: The siRNA was purchased from TriLink Biotechnologies with HPLC purification ...
-
bioRxiv - Biochemistry 2024Quote: ... commercial CleanCap Fluc mRNA was used (Trilink).
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM XTP (TriLink Biotechnologies), or no nucleotide to acquire baseline measurement for 30 seconds ...
-
bioRxiv - Bioengineering 2024Quote: ... with CleanCap Reagent AG (TriLink Biotechnologies) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Firefly luciferase (Fluc) mRNA was purchased from Trilink Biotechnologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and m1-pseudouridine-5’-triphosphate (TriLink, N-1081). Template DNA was digested with Turbo DNase ...
-
bioRxiv - Bioengineering 2024Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Bioengineering 2024Quote: ... a 1:1 mixture of CRISPR-Cas9 mRNA (TriLink, San Diego, CA, USA) to sgRNA (IDT ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2’-fluoro modified CTP and 2’-fluoro modified UTP (TriLink Biotechnologies). All RNA aptamers were purified through denaturing polyacrylamide gel electrophoresis (0.75 mm ...
-
bioRxiv - Biophysics 2024Quote: ... The LNP cargo contained Cy5-labeled (TriLink Bio Technologies) and non-labeled eGFP-encoding mRNA at a 1:4 molar ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... all of the UTP in the reaction was replaced by Ψ (TriLink). The in vitro synthesized mRNA was purified ...
-
bioRxiv - Bioengineering 2024Quote: ... CleanCap (TriLink). mRNA was purified by cellulose (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... m1Ψ-5′-triphosphate (TriLink) instead of UTP was used to generate modified nucleoside-containing mRNA ...
-
bioRxiv - Bioengineering 2024Quote: HPLC-purified synthetic chemically modified sgRNAs were purchased from TriLink Biotechnologies (San Diego ...
-
bioRxiv - Bioengineering 2024Quote: ... mRNA for most experiments was purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Bioengineering 2024Quote: ... ABE8e mRNA was produced by Trilink Biotechnologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Modified aptamers that carried both 2’FY and 2’OMeR were purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Bioengineering 2024Quote: ... FAM modified CpG (i.e., FAM-CpG) was purchased from Trilink Bio-Technology (San Diego ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cas9 mRNA (CleanCap, 5-methoxyuridine-modified) was purchased from TriLink Biotechnologies ...
-
bioRxiv - Immunology 2024Quote: ... was prepared in injection buffer by mixing 500 ng/μl of each of the sgRNAs (left and right) with Cas9 mRNA (1 μg/μl, TriLink, cat # L-6125). Fertilized eggs collected from B6/129 mice were microinjected at the CHOP transgenic core and transferred into pseudo-pregnant B6 females ...
-
bioRxiv - Cell Biology 2024Quote: ... with 1.6 µg of DNA template used per 40 µL reaction with a ribonucleoside mix containing 10 mM ARCA (Trilink Biotechnologies), 2.7 mM GTP ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2-thio UTP were purchased from TriLink Biotechnologies (San Diego ...
-
bioRxiv - Neuroscience 2024Quote: ... 62 The two CBE mRNAs were synthesized by Trilink (San Diego, CA) using in vitro transcription at 1 mg scale from PCR amplicons of the two expression plasmids.
-
bioRxiv - Cell Biology 2024Quote: The mDrp1-KI mice were generated using Cas9 mRNA (TriLink Bio, L6125100), sgRNA and single-strand DNA homology-directed repair (HDR ...
-
bioRxiv - Cancer Biology 2024Quote: ... rrsp- mRNA or CleanCap® mCherry-mRNA (TriLink BioTechnologies) in 25 mM sodium acetate buffer at the weight ratio of 40:1 to assemble monodisperse spherical complexes for mRNA transfection or fluorescent tracing of cell transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... and an mRNA for expression of the RAS/RAP1 protease (also known as Vibrio vulnificus MARTX toxin DUF5) (rrsp-mRNA) and a H451A catalytically inactive negative control mRNA (rrsp*-mRNA) were synthesized by TriLink BioTechnologies ...
-
bioRxiv - Bioengineering 2024Quote: ... were purchased from TriLink Biotechnologies ...
-
bioRxiv - Bioengineering 2024Quote: ... 5moU nucleoside-modified firefly luciferase mRNA was purchased from TriLink BioTechnologies (Cat# L-7202).
-
bioRxiv - Bioengineering 2024Quote: ... Transfection reaction was prepared by adding 1.5 μg chemically modified SpCas9 mRNA (CleanCap®, Trilink) along with 1 μg chemically modified sgRNA (Integrated DNA Technologies ...