Labshake search
Citations for TriLink BioTechnologies :
1 - 50 of 533 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... co-transcriptionally capped with CleanCap Reagent AG (TriLink N-7113), treated with TURBO DNase (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... the T7 promoter sequence was changed to GCTAATACGACTCACTATAAGG and CleanCap AG (TriLink N-7113) was added to the in vitro transcription reaction according to manufacturer protocols.
-
bioRxiv - Systems Biology 2024Quote: ... N1-methylpseudouridine substituted RNAs were produced by the complete replacement of uridine triphosphate in the T7 transcription reaction with N1-methylpseudouridine triphosphate (Trilink N-1081). Uridine and N1-methylpseudouridine RNAs were then mixed in equimolar ratios prior to in vitro translation.
-
bioRxiv - Molecular Biology 2024Quote: ... the unique DNA barcodes were directly conjugated to the antigen using a SoluLINK Protein-Oligonucleotide Conjugation kit (TriLink, S-9011) according to kit protocol ...
-
bioRxiv - Genomics 2024Quote: ... and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No. N-7113) to generate a 5’ Cap1 structure ...
-
bioRxiv - Genomics 2024Quote: ... Transcription reactions were set up with complete substitution of uracil by N1-methylpseudouridine (Trilink BioTechnologies Cat No. N-1080) and co-transcriptional 5’ capping with the CleanCap AG analog (Trilink BioTechnologies Cat No ...
-
A nascent riboswitch helix orchestrates robust transcriptional regulation through signal integrationbioRxiv - Molecular Biology 2024Quote: ... 10 µM ApU dinucleotide primer (Trilink), and 50 nM DNA template ...
-
bioRxiv - Cancer Biology 2024Quote: ... and either 7.5 mM GTP or 6.75 mM 7-deazaguanine (TriLink N-1044) plus 0.75 mM GTP was used ...
-
bioRxiv - Developmental Biology 2024Quote: ... mCherry and Cre-recombinase were used (Trilink Biotechnologies). Encapsulation of modified mRNAs for intracameral injection was performed using Lipofectamine Messenger Max transfection reagent (Thermo Fischer ...
-
bioRxiv - Developmental Biology 2024Quote: ... These reagents included the Bxb1 mRNA (Trilink) at 100ng/µl ...
-
bioRxiv - Immunology 2024Quote: ... Methyl-pseudouridine (SYNTHGENE)-modified mRNAs were capped using Cap1 Analogue Reagent (TriLink) and further purified by Monarch RNA purification columns (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... transduced activation reporter cells were enriched by puromycin selection (1µg mL-1) following nucleofection of dCas9-VPR mRNA (TriLink) and a Cas9 sgRNA targeting the ESR protospacer (IDT) ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of Cas9 mRNA (50 ng/ µl, #L-6125, TriLink Biotechnologies) and two specific gRNAs (25 ng/ µl each ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng CleanCap Cas9 (5moU) mRNA (Trilink, L-7206) was electroporated into the cells using the Neon™ Transfection System (ThermoFisher) ...
-
bioRxiv - Genomics 2024Quote: ... 1 mM ATP or a modified ATP analog (Trilink, 2’-O-Methyladenosine-5’-Triphosphate ...
-
bioRxiv - Immunology 2024Quote: ... Modified mRNA transcript with full substitution of Pseudo-U was synthesized by TriLink Biotechnologies using proprietary CleanCap® technology ...
-
bioRxiv - Immunology 2024Quote: ... Unmodified synthesized ANKRD55 mRNA transcript was capped at the 5’ end using wild-type bases CleanCap® AG (TriLink BioTechnologies) to generate a natural Cap 1 structure ...
-
bioRxiv - Immunology 2024Quote: ... 3 μl T7 RNA polymerase (Biolabmix) and 10xBuffer (TriLink), 4 mM trinucleotide cap 1 analog ((3′-OMe-m7G)-5′-ppp-5′-(2′-OMeA)pG ...
-
bioRxiv - Bioengineering 2024Quote: The siRNA was purchased from TriLink Biotechnologies with HPLC purification ...
-
bioRxiv - Biochemistry 2024Quote: ... commercial CleanCap Fluc mRNA was used (Trilink).
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM XTP (TriLink Biotechnologies), or no nucleotide to acquire baseline measurement for 30 seconds ...
-
bioRxiv - Bioengineering 2024Quote: ... with CleanCap Reagent AG (TriLink Biotechnologies) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: Firefly luciferase (Fluc) mRNA was purchased from Trilink Biotechnologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and m1-pseudouridine-5’-triphosphate (TriLink, N-1081). Template DNA was digested with Turbo DNase ...
-
bioRxiv - Bioengineering 2024Quote: ... according to the manufacturer’s instructions with modifications as using the CleanCap® Reagent AG (TriLink, N-7413) and m1-pseudouridine-5’-triphosphate (TriLink ...
-
bioRxiv - Bioengineering 2024Quote: ... a 1:1 mixture of CRISPR-Cas9 mRNA (TriLink, San Diego, CA, USA) to sgRNA (IDT ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2’-fluoro modified CTP and 2’-fluoro modified UTP (TriLink Biotechnologies). All RNA aptamers were purified through denaturing polyacrylamide gel electrophoresis (0.75 mm ...
-
bioRxiv - Biophysics 2024Quote: ... The LNP cargo contained Cy5-labeled (TriLink Bio Technologies) and non-labeled eGFP-encoding mRNA at a 1:4 molar ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... all of the UTP in the reaction was replaced by Ψ (TriLink). The in vitro synthesized mRNA was purified ...
-
bioRxiv - Bioengineering 2024Quote: ... CleanCap (TriLink). mRNA was purified by cellulose (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... m1Ψ-5′-triphosphate (TriLink) instead of UTP was used to generate modified nucleoside-containing mRNA ...
-
bioRxiv - Bioengineering 2024Quote: HPLC-purified synthetic chemically modified sgRNAs were purchased from TriLink Biotechnologies (San Diego ...
-
bioRxiv - Bioengineering 2024Quote: ... mRNA for most experiments was purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Bioengineering 2024Quote: ... ABE8e mRNA was produced by Trilink Biotechnologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Modified aptamers that carried both 2’FY and 2’OMeR were purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Neuroscience 2024Quote: ... 62 The two CBE mRNAs were synthesized by Trilink (San Diego, CA) using in vitro transcription at 1 mg scale from PCR amplicons of the two expression plasmids.
-
bioRxiv - Cell Biology 2024Quote: The mDrp1-KI mice were generated using Cas9 mRNA (TriLink Bio, L6125100), sgRNA and single-strand DNA homology-directed repair (HDR ...
-
bioRxiv - Cancer Biology 2024Quote: ... rrsp- mRNA or CleanCap® mCherry-mRNA (TriLink BioTechnologies) in 25 mM sodium acetate buffer at the weight ratio of 40:1 to assemble monodisperse spherical complexes for mRNA transfection or fluorescent tracing of cell transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... and an mRNA for expression of the RAS/RAP1 protease (also known as Vibrio vulnificus MARTX toxin DUF5) (rrsp-mRNA) and a H451A catalytically inactive negative control mRNA (rrsp*-mRNA) were synthesized by TriLink BioTechnologies ...
-
bioRxiv - Bioengineering 2024Quote: ... were purchased from TriLink Biotechnologies ...
-
bioRxiv - Bioengineering 2024Quote: ... 5moU nucleoside-modified firefly luciferase mRNA was purchased from TriLink BioTechnologies (Cat# L-7202).
-
bioRxiv - Bioengineering 2024Quote: ... Transfection reaction was prepared by adding 1.5 μg chemically modified SpCas9 mRNA (CleanCap®, Trilink) along with 1 μg chemically modified sgRNA (Integrated DNA Technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... was purchased from TriLink Bio Technologies (CleanCap EGFP mRNA ...
-
bioRxiv - Bioengineering 2024Quote: ... Additional samples adding 0.25 μM CpG ODN 1826 (CpG, Trilink Biotechnology, San Diego, CA) and 0.25 μM Lipidated CpG to the PAs were utilized to determine if their association with the micellar structure affected nanoparticle size and shape ...
-
bioRxiv - Bioengineering 2024Quote: ... 5-methoxyuridine (5moU) modified mRNA was purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Physiology 2024Quote: ... These two sgRNAs (20 ng/ul each) were co-microinjected with Cas9 mRNA (50 ng/ul, TriLink BioTechnologies) into the cytoplasm of zygotes collected from ChR2-EYFP mouse mating pairs ...
-
bioRxiv - Immunology 2024Quote: ... 5-methylcytidine triphosphate and pseudouridine triphosphate (TriLink Biotechnologies). Final nucleotide concentrations in the reaction mixture were 6 mM for the cap analog ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μL of ddNTPs (2 mM each, TriLink) and 1 μL of terminal transferase (20 units ...
-
Development and Initial Characterization of Pigs with DNAI1 Mutations and Primary Ciliary DyskinesiabioRxiv - Physiology 2024Quote: ... were mixed with s.p.Cas9 mRNA (TriLink BioTechnologies, San Diego, CA), 20 ng/μl final concentration ...
-
bioRxiv - Bioengineering 2024Quote: ... mRNA with 5- methoxyuridine (5moU) modification encoding mCherry or firefly luciferase (TriLink) was dissolved in citrate butter (pH 3) ...