Labshake search
Citations for Promega :
351 - 400 of 636 citations for Vertical Gel Casting Cassettes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Products were cleaned with the Wizard® SV Gel and PCR Clean-Up System (Promega) and cloned with the pGEM®-T Vector Systems (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was purified using Wizard SV Gel and PCR Clean-Up System (Promega). The linearized Donor was combined with the HCMV GW BAC in a Gateway reaction with LR Clonase II Plus enzyme (Thermo-Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... and purified using the Wizard SV Gel system and the PCR Clean-Up System (Promega).
-
bioRxiv - Developmental Biology 2023Quote: ... The obtained products were gel purified and cloned into the pGEM-T Easy Vector (Promega). Individual clones were sequenced and analyzed.
-
bioRxiv - Genetics 2023Quote: ... PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega) in line with the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting amplification product was gel purified and ligated to a pGEMT-easy (Promega, USA) vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... the DNA was purified using the Wizard SV Gel and PCR Clean Up Kit (Promega). Immunoprecipitated DNA was analyzed by qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... followed by gel purification of the 4725 bp band using a Wizard spin column (Promega). A multiple cloning site linker was prepared by annealing the primers oMJF055 and oMJF056 at 8 µM each in a buffer of 50 mM Tris HCl pH7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Reduced and alkylated proteins were in-gel digested with 100 ng trypsin (modified sequencing grade, Promega) overnight at 37°C ...
-
bioRxiv - Systems Biology 2019Quote: ... loaded onto a polyacrylamide gel and digested overnight at 37°C with trypsin (Promega, Wisconsin, USA) at an enzyme-to-protein ratio of 1:100.
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were digested in-gel with trypsin (0.17 μg in 10 μl 40 mM NH4HCO3, Promega) at 37°C over night ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The band was excised and the Wizard® SV Gel and PCR Clean-up System (Promega) to extract and purify the DNA from the gel ...
-
bioRxiv - Genomics 2019Quote: The PCR products were excised from agarose gels and ligated into pGEM-T vector plasmids (Promega) with T4 DNA ligase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: Amplified fragments were purified using a Wizard SV Gel and PCR Clean-Up System (Promega #A9281), diluted at a concentration of 1 µg/20 µl ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... stained with Coomassie blue R-250 and in-gel digested using modified trypsin (Promega, sequencing grade) as previously described[70] ...
-
bioRxiv - Genomics 2021Quote: ... The amplicons were gel-purified and cloned into pGEM®-T Easy Vectors (Promega, Cat. #: A1360) using standard TA cloning techniques ...
-
bioRxiv - Genetics 2021Quote: ... from the 1% TAE agarose gel and cloned into the pGEM-T Easy Vector System (Promega) for transformation ...
-
bioRxiv - Cell Biology 2021Quote: ... Gel pieces were rehydrated in 25 mM ammonium bicarbonate containing 200 ng of trypsin (V5113, Promega) and the samples were digested for 14 hours at 37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR products were purified with the Wizard SV Gel and PCR Clean-Up System (Promega) and cloned into the pGEM-T Easy Vector (Promega ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified using a Wizard® SV Gel and PCR Clean-up System (Promega). Samples were barcoded using Oxford Nanopore PCR barcodes (EXP-PBC001 ...
-
bioRxiv - Systems Biology 2020Quote: ... after which they were subjected to in-gel tryptic digestion using sequencing grade trypsin (Promega, V5113). After digestion ...
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained DNA was purified using the Wizard SV Gel and PCR Clean up system (Promega, US) in a final volume of 50 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-up system (Promega). A guide sequence (TATTCGAGGCCATCGTGTACCGG ...
-
bioRxiv - Cell Biology 2021Quote: ... dried gel pieces were rehydrated in 50µl of 12 ng/µl LysC/Trypsin (Promega, Madison, WI), 0.01% ProteaseMAX surfactant (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... The gel slices were cooled on ice and a cold solution of trypsin (Promega, Madison, WI) 12.5 ng/μL ...
-
bioRxiv - Cell Biology 2022Quote: ... In-gel digestion was performed overnight with mass spectrometry grade trypsin (Trypsin Gold, Promega, Cat# V5280) at 5 ng/μL in 50 mM NH4HCO3 digest buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... reduced and alkylated prior to in-gel trypsin digestion employing sequence grade-modified trypsin (Promega, USA), as described in detail elsewhere (46-48) ...
-
bioRxiv - Neuroscience 2021Quote: ... In-gel digestion was performed using 5 ng/μL mass spectrometry-grade trypsin (Trypsin Gold, Promega) in 50 mM NH4HCO3 digestion buffer ...
-
bioRxiv - Zoology 2020Quote: ... PCR products were purified with the Wizard SV Gel and PCR Clean–Up System (Promega, USA) and sent for sequencing to Macrogen Inc ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products were purified (Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI)) and sequenced at the UC Davis DNA Sequencing Facility http://dnaseq.ucdavis.edu/.The DNA sequences were compared against the National Center for Biotechnology Information (NCBI ...
-
bioRxiv - Microbiology 2021Quote: ... and primers using Wizard® SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA). Cleaned amplified products were again run (5μl loaded ...
-
bioRxiv - Microbiology 2019Quote: ... The gels were dried by Speed-Vac and digested with trypsin (0.01μg/μl) (Promega, Madison, WI) in 10 mM NH4HCO3 at 37 °C overnight ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega). Purified genomic DNA and RT PCR products (100 ng ...
-
bioRxiv - Plant Biology 2022Quote: ... In-gel proteolytic digestion was performed overnight at 37°C using either sequencing-grade trypsin (Promega) or EndoGluC (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Wizard SV Gel and PCR Clean-Up System kit (Promega) and ligated into pET17b vector using the Gibson Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Plant Biology 2023Quote: ... the gels were soaked with 50 mM TEAB containing 10 ng/µl Sequencing Grade Trypsin (Promega) and incubated at 40 °C for 8 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... and subjected to in-gel digestion with trypsin/Lys-C Mix (V5071, Promega, Madison, WI, USA) at 37°C for 12 h ...
-
bioRxiv - Biophysics 2023Quote: ... and extracted each from the gel using a standard protocol from PCR purification kit (Promega, A9282). We then mixed the three fragments together in 10 µl in molar ratio 1:2:1 ...
-
Short-range interactions between fibrocytes and CD8+ T cells in COPD bronchial inflammatory responsebioRxiv - Pathology 2023Quote: Proteins were digested by incubating each gel slice with 10 ng/µl of trypsin (V5111, Promega) in 40 mM NH4HCO3 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Wizard® SV Gel and PCR Clean-Up system (Promega) and then sequenced by Sanger sequencing at GENEWIZ (South Plainfield ...
-
bioRxiv - Neuroscience 2023Quote: ... the 130-kDa band was cut out as a gel piece and digested with trypsin (Promega) at 37°C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... In-gel digestion was performed overnight at 37 °C with MS grade endo Trypsin/LysC (Promega). The digested peptides were dried using a speedvac and stored at − 20 °C until further processed ...
-
bioRxiv - Biochemistry 2024Quote: ... in-gel digestion using 10 ng/µL of sequencing grade modified trypsin (Promega, Madison, WI, USA) was performed overnight at 37 °C.
-
bioRxiv - Biophysics 2024Quote: ... gel plugs were crushed into small pieces and 5–10 μg of sequencing-grade trypsin (Promega) per ∼100 μg protein were added ...
-
bioRxiv - Microbiology 2024Quote: ... ChIP eluates were purified with Wizard SV Gel and PCR clean-up system (Promega, Cat# A9282). Primer sequences are shown in Table S2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were renatured and assayed according to the Nano-Glo® In-Gel Detection System protocol (Promega). Light produced by NLuc was captured using a Chemidoc MP Imager (Biorad).
-
bioRxiv - Neuroscience 2019Quote: ... Gel pieces were dehydrated using ACN and subjected to overnight digestion with sequencing grade modified trypsin(Promega) at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... and digested vector was isolated using the Promega Wizard SV gel extraction and PCR cleanup kit (Promega). Products were then ligated overnight at 16°C following the NEB T4 DNA ligase protocol with 50 ng of pSLQ615 ...
-
bioRxiv - Biochemistry 2021Quote: ... and stained with Coomassie blue R-250 before in-gel digestion using modified trypsin (Promega, sequencing grade) as previously described 74 ...