Labshake search
Citations for Promega :
251 - 300 of 4937 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and 1-3μl aliquots were taken for reverse transcription (RT) using the Moloney murine leukemia virus RT RNase H (−) (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The quantification of viral RNA was carried out in one-step RT-qPCR using 3 µl of the eluted RNA with the GoTaq® Probe One-step RT-qPCR System (Promega, Poland). This procedure employed in-house primers and a probe specifically tailored for the HCoV-229E N sequence ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was synthesized using M-MLV RT (H–) (Promega) and U3 antisense primer 5’-TGTGTGGTAGATCCACATCG-3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 µL reverse transcriptase (RT, Promega, Madison, Wisconsin, US) and RNase-free water were added ...
-
bioRxiv - Pathology 2022Quote: ... 200 units reverse transcriptase (M-MLV RT, M1701, Promega), 2mM dNTPs and 20 units RNAsin (N2615 ...
-
bioRxiv - Immunology 2020Quote: ... and M-MLV RT RNAse (H-) Point Mutant (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 5 μL of 5X RT buffer (Promega), 5 μL of dNTPs ...
-
bioRxiv - Molecular Biology 2021Quote: ... the GoTaq® 1-Step RT-qPCR System (Promega) was used with the primers (F ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were equilibrated to RT and CellTiter-Glo (Promega) solution (100μL ...
-
bioRxiv - Biochemistry 2021Quote: ... and GoTaq® 1-Step RT-qPCR System (Promega) were used for RT-qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... using M-MLV-RT and random hexamer primers (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Microbiology 2023Quote: ... using M-MLV-RT and random hexamer primers (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: qPCRs were performed with MLV SuMLV primers using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes against siRNA populations were PCR products labelled with the Prime-a-Gene kit (Promega). Over-night hybridization at 42°C was in PerfectHyb buffer (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... PCR-amplification of both nosZ genes used the Promega GoTaq qPCR kit (Promega, Madison, WI) and 1 μL of DNA template (25-50 ng genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR2 products were cleaned up and concentrated by SV wizard PCR cleanup kit (Promega), Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplicons were purified using a Wizard SV Gel and PCR Clean up System kit (Promega) and EcoRI/XhoI digested pGREG533 was gel purified using a Qiaex II kit (Qiagen) ...
-
bioRxiv - Bioengineering 2020Quote: ... The first PCR products were purified using a commercial purification kit (Promega, Madison, WI, USA), diluted ...
-
bioRxiv - Immunology 2021Quote: ... quantitative real-time PCR was carried out using the GoTaq qPCR Master Mix kit (Promega) with 20 µL of reaction mixture containing gene-specific primers or the PrimePCR assay kit (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the linearized DNA was purified using the Wizard® SV Gel PCR purification kit (Promega). For the synthesis of 5’-capped mRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... The quantitative real-time PCR was performed using the GoTaq qPCR Master Mix kit (Promega) following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2024Quote: ... the DNA was purified using the Wizard SV Gel and PCR Clean Up Kit (Promega). Immunoprecipitated DNA was analyzed by qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Pathology 2020Quote: ... cDNA synthesis from the mRNA was performed using a Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) kit (Promega, Madison, Wisconsin, USA) in a Mastercycler® Gradient (Eppendorf ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 μL of N2 primers and probe (2019-nCov CDC EUA Kit, Integrated DNA Technologies) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Microbiology 2023Quote: ... the presence of other main circulating arboviruses was evaluated by RT-qPCR using GoTaq® 1-Step RT-qPCR System (Promega, Madison, WI, USA). Specific diagnosis primers were used for Zika [30] ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription (RT) was performed with AMV reverse transcriptase (Promega) in final volume 20 μl for 1h at 42°C on 1 μg of total RNA in the presence of two reverse primers (1 μl of 5 μM solution each ...
-
bioRxiv - Microbiology 2020Quote: ... and then cDNA was produced using M-MLV RT (Promega) and random hexamers ...
-
bioRxiv - Neuroscience 2022Quote: ... using GoTaq® Probe 1-Step RT-qPCR System (Promega). The CDC SARS-CoV-2 nucleoprotein N2 primer set was used for amplification ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using GoTaq qPCR Master Mix (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 μL of reverse transcriptase (M-MLV RT, Promega) and incubated the samples for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... using the GoTaq 1-Step RT-qPCR System (Promega, USA) and primers targeting the gene coding for the endogenous control β-actin ...
-
bioRxiv - Molecular Biology 2020Quote: ... RT-qPCR was performed using GoTaq qPCR Master mix (Promega). Cycling conditions were as follows ...
-
bioRxiv - Immunology 2020Quote: ... using the MMLV-RT reverse transcriptase enzyme (Promega, Madison WI) to obtain the complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mM dNTP) and 1 μl of AMV RT (Promega) was added and the sample was incubated at 42 °C for 1 hour ...
-
bioRxiv - Physiology 2020Quote: ... Reverse transcription (RT) was performed with AMV-reverse transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Biophysics 2023Quote: ... Reverse transcription was performed with M-MLV RT (Promega, USA) according to the manufacturer protocol with the primer Pow-TBE-3’ ...
-
bioRxiv - Genomics 2019Quote: ... PCR was performed with gene-specific primer pairs (Table S15) using a DNA polymerase kit (Promega). The PCR conditions were 95 °C for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was run with genomic DNA that was prepared with Wizard Genomic DNA Purification Kits (Promega).
-
bioRxiv - Genomics 2023Quote: ... The single-stranded DNA generated using this method was purified using PCR purification kit (A9285; Promega) and quantified using Nanodrop ...
-
bioRxiv - Biophysics 2023Quote: ... and extracted each from the gel using a standard protocol from PCR purification kit (Promega, A9282). We then mixed the three fragments together in 10 µl in molar ratio 1:2:1 ...
-
bioRxiv - Microbiology 2020Quote: ... a PCR reaction using the PCR Master Mix (Promega) and the primers rplU_Fwd and rplU_Rev (Table 2 ...
-
bioRxiv - Genetics 2022Quote: ... PCR was performed using GoTaq PCR Master Mix (Promega) with primers mo37 and ag489 ...
-
bioRxiv - Biophysics 2022Quote: ... Two PCR reactions using GoTaq G2 PCR mix (Promega) and a pUC19 template were set up ...
-
bioRxiv - Developmental Biology 2022Quote: ... and purified using a Nucleospin PCR clean-up kit and subcloned into p-GEM T-easy (Promega). Antisense RNA probes were synthesized using T3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The DNA used for the different PCRs were purified by using the Wizard® Genomics Kit (Promega).
-
bioRxiv - Bioengineering 2021Quote: ... and digested vector was isolated using the Promega Wizard SV gel extraction and PCR cleanup kit (Promega). Products were then ligated overnight at 16°C following the NEB T4 DNA ligase protocol with 50 ng of pSLQ615 ...
-
bioRxiv - Neuroscience 2021Quote: ... was purified using gel clean-up kit (Wizard® SV Gel and PCR Clean-Up, A9281, Promega) (Figure S4B) ...
-
bioRxiv - Zoology 2021Quote: ... Those containing single bright bands were purified using Wizard SV Gel and PCR Clean-up Kit (Promega), and sequenced in both directions using PCR primers at Sequetech Inc ...
-
bioRxiv - Immunology 2021Quote: Targeted re-sequencing by the Sanger method (Microsynth AG) was performed on kit purified PCR products (Promega) from chromosomal DNA or expression vector templates using pre-mixed sequencing primers listed Table S2.