Labshake search
Citations for Promega :
51 - 100 of 4937 citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT-PCRs were performed with the GoTaq qPCR Master Mix (Promega), 2% of cDNA per reaction ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR was performed using GoTaq® DNA polymerase (Promega, https://www.promega.com) and corresponding primers for 28 cycles ...
-
bioRxiv - Microbiology 2022Quote: Semi-quantitative RT-PCR was carried out using GoTaq DNA polymerase (Promega) with 16S rRNA primers (16S F and 16S R ...
-
bioRxiv - Molecular Biology 2023Quote: RT-PCR was performed using the GoTaq G2 DNA Polymerase (M7845, Promega) with 3 μl of reverse transcriptase product and the following primers ...
-
bioRxiv - Plant Biology 2023Quote: ... and RT-PCR was performed using Go-Taq polymerase (Promega, WI, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... RT-qPCR was performed using SYBR Green PCR Master Mix (A6002, Promega) with the gene-specific primers (Table S9) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Microbiology 2023Quote: ... viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate RNA standard ...
-
bioRxiv - Zoology 2024Quote: One-step RT-qPCR was conducted using GoTaq 1-Step RT-qPCR System kit (Promega, France) in total reaction volume of 20 µl containing 2 µl of RNA extracts and 300 nM of the same forward and reverse primers as above ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed using the GoTaq 1-Step RT-qPCR kit (Promega Cat. No. A6020) using nifH and 16S rRNA (reference gene ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1 step RT-qPCR kit, Promega). Quantification was provided by serial dilutions of an appropriate T7-generated synthetic RNA standard ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-PCR reactions were conducted using the GoTaq qPCR Master Mix (A6001, Promega) and a MasterCycler Ep-Realplex thermal cycler (Eppendorf).
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR was performed using GoTaq® qPCR Master Mix (Promega, Shanghai, China) and specific primers (Sangon Biotech ...
-
bioRxiv - Microbiology 2019Quote: Reverse transcriptase (RT)-PCR was carried out using ImProm-II reverse transcriptase (Promega) following the manufacturer’s protocol with 1 µg of RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was then performed using the SYBR Green qPCR Master Mix (Promega). Primer sequences are available upon request ...
-
bioRxiv - Cancer Biology 2023Quote: ... The isolated RNAs (20 ng) were reverse-transcribed and quantitative PCR (qPCR) were perform using GoTaq Probe 1-Step RT-PCR system (Promega) in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... Gene expression analysis was done by RT-PCR (GoTaq qPCR Master Mix, Promega, USA) using gene specific primers (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative RT-PCR was performed in triplicates with the GoTaq qPCR Master Mix (Promega) on a LightCycler 480 II PCR system (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RT-PCR was carried out using SYBR Green master mix (Sybr Green-A6001 Promega) for detection in Light cycler LC 480 (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... using the GoTaq® 2-step RT-qPCR kit (Promega). Quantitative PCR runs were performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using PCR cleanup kit (Promega). Sanger sequencing was performed at Psomagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated RNA was used for cDNA synthesis using the Access RT-PCR system (Promega) with AMV reverse transcriptase ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1-step qRt-PCR, Promega) using 3.8μL of extracted RNA and 6.2μL of RT-qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Neuroscience 2021Quote: ... The temporal expression of genes was characterized RT-PCR using GoTaq Master Mix (M712C, Promega) and oligonucleotide sequences are listed at https://zebrafishproject.ucsf.edu ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1-step qRt-PCR, Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was quantified by real-time RT-qPCR (GoTaq 1-step qRt-PCR, Promega) using 3.8 µL of extracted RNA and 6.2 µL of RT-qPCR mix and standard fast cycling parameters ...
-
bioRxiv - Genetics 2019Quote: ... and cDNA synthesis (M-MLV RT kit, Promega Corporation, cat. #M170A) were performed according to manufacturer’s specifications [21] ...
-
bioRxiv - Neuroscience 2020Quote: ... Reverse transcription was performed with an RT cDNA Synthesis Kit (Promega). Real-time PCR was performed with SYBR green SuperMix using an iCycler real-time PCR detection system (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... and reverse transcribed (RT) using the Reverse Transcription System kit (Promega). The resulting cDNA samples were amplified by TaqMan quantitative PCR using commercially available primer/probe kits from Applied Biosystems for BDNF (Gene Expression Assay Mm00432069_m1 ...
-
bioRxiv - Genetics 2020Quote: RNA was reverse-transcribed using the GoScript RT kit (Promega A5000) following the kit protocol ...
-
bioRxiv - Physiology 2022Quote: ... Reverse transcription (RT) was performed with M-MLV enzyme kit (Promega) and qPCR was conducted with the Syber GreenER qPCR Super Mix Universal (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µl of the RT product (diluted 1:5) was used for semi-quantitative PCR or qPCR reactions with Promega PCR Mix (Promega, Madison, Wisconsin, USA) and SYBR Green PCR Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time quantitative PCR (RT-qPCR) was performed with GoTaq qPCR Master Mix (Promega; Cat#: A6002). Gene expression analysis was calculated following normalization to PPAI using the comparative Ct (cycle threshold ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Developmental Biology 2022Quote: ... the ARF3 coding region was amplified by RT-PCR and cloned into pGEM-T-easy (Promega). The resulting plasmid was digested with SpeI and transcribed with T7 RNA polymerase to generate the antisense probe ...
-
bioRxiv - Genomics 2021Quote: ... The RT-PCR experiments were conducted using the GoTaq G2 Hot Start Master mix (Promega #M7422). The PCR primers were listed in the Supplementary Figure S5 ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was subjected to RT-PCR in accordance with the protocol provided by Promega. The transcripts were quantitated and normalized to the internal GAPDH control ...
-
bioRxiv - Genetics 2021Quote: ... RT-PCR was performed by using GoTaq® DNA polymerase (Promega, 2800 Woods Hollow Road·Madison, USA) in an Applied Biosystems™ Veriti™ Thermal Cycler ...
-
bioRxiv - Immunology 2022Quote: ... Target gene expression was determined by quantitative RT-PCR using GoTaq qPCR Master mix (Promega, A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using the GoTaq QPCR Master Mix (Promega, A6001) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR products were purified using PCR purification kit (Promega, WI, US), and ligated into PCR II Topo-vector (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... or Wizard PCR purification kit (Promega), and then directly sequenced using the same and internal primers on an ABI 3130xl sequencer.
-
bioRxiv - Cell Biology 2021Quote: ... One µg RNA was reverse transcribed using the MLV RT kit (Promega). The GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The GoTaq® qPCR and RT-qPCR Systems kit (Promega, Beijing, China) was used to quantify the transcript abundance on the ABI 7500 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... and reverse transcribed into cDNA using the Promega RT Kit (Promega, A3500). RT-qPCR was performed using specific primer sequences for FOXG1 (F-CGTTCAGCTACAACGCGCTCA ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-PCR was performed with the GoTaq® Green Master Mix as per manufacturer’s instructions (Promega, USA). For RIP analysis ...
-
bioRxiv - Biochemistry 2021Quote: Purified RT-PCR products were cloned in to pGEM vector using pGEM- T easy vector Systems (Promega) as described by manufacturer and transformed into heat- competent 10-Beta cells (NEB) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR products were purified using a Wizard PCR clean-up kit (Promega) before sequencing (Eurofins Genomics).
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...