Labshake search
Citations for Promega :
351 - 400 of 6245 citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... falciparum 3D7 DNA with commercially available human DNA (Promega, G304A) to a total amount of 400ng DNA ...
-
bioRxiv - Neuroscience 2024Quote: Human male genomic DNA obtained from Promega (Ref:G1471; Madison, WI) was used to generate the input library ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... 24h prior to imaging cells were co-transfected with human PEX31-42-GFP-Halo and either human HAP1-mCherry-eDHFR or mouse BICD21-572-mCherry-eDHFR using FuGENE 6 (Promega; 1 µg total DNA) and 48h prior to imaging with control siRNA using Lipofectamine RNAiMAX (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were pulsed for 4 h with CellTiter 96 Aqueous One solution reagent (Promega). Cell viability was measured by a luminometer ...
-
bioRxiv - Developmental Biology 2020Quote: ... Assays were performed 48 h later using the Dual-Glo Luciferase Assay System (Promega). The basal activity of the empty luciferase vector was set as 1.0 ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were harvested 24–48 h after transfection/infection in passive lysis buffer (Promega). The samples were prepared according to the manufacturer’s protocol (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... and goat anti-rabbit IgG (H+L) antibody conjugated to HRP (Promega, catalog # W4018). Immunoblots were imaged using iBright 1500 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... After 24 h viability of cells was measured using CTG assay (Promega, Madison, USA). The luminescence was read with a PHERAstar FS plate reader (BMG Labtech ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Microbiology 2020Quote: ... 72 and 120 h post-treatment using the Renilla-Glo luciferase assay system (Promega) and a GloMax Discover multimode microplate reader (Promega) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Bioengineering 2022Quote: ... Horseradish peroxidase-conjugated anti-rabbit IgG (H + L) secondary antibody (W401B; Promega, Madison, WI) was used at a dilution rate of 1:5,000 for anti-TNF-α or -IL- 1β blotting ...
-
bioRxiv - Microbiology 2022Quote: ... Cell lysates were harvested 24 h after infection in Reporter Lysis Buffer (Promega, E397A), lysed by freeze thawing at -80°C ...
-
bioRxiv - Immunology 2022Quote: ... After 18 h the neutralization assay was developed with a luciferase assay system (Promega), and the relative light units (RLU ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA libraries were generated using M-MLV RT [H-] Point mutant (Promega, WI, USA) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2021Quote: ... Relative luciferase units (RLU) were measured 65 h post-infection (Promega Bright-Glo, E2620) in the infection plates with a black back-sticker (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and then ligated for 16 h at 4 °C with T4 DNA ligase (Promega). After a further purification step ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was initiated by addition of a mixture of 2 μM coelenterazine-h (Promega) and 40 μM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Biochemistry 2021Quote: The fused peptide–mRNA was subsequently reverse transcribed using MMLV RT RNase H- (Promega) for 1 h at 42 °C and 0.5 μL aliquot of the peptide-mRNA fusions was taken from the mixture and saved for the determination of the total amount of inputted mRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... ~24 h post transfection cells were lysed with 70 uL Glo Lysis buffer (Promega) by incubating for 5 min on a shaker at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Transduction efficiency was measured after 72 h puromycin treatment using CellTiter-Glo (CTG, Promega) (50 µl of cell suspension + 50 µl CTG) ...
-
bioRxiv - Microbiology 2022Quote: ... NTD and Spike - was achieved for 24 h using ProFection Mammalian Transfection System (Promega) or adenovirus infection ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested for 18 h with trypsin/Lys-C Mix (Promega Corporation, USA) and 10 μg of each sample was used for proteome analysis ...
-
bioRxiv - Immunology 2023Quote: ... After 16 h of incubation the cells were lysed in Passive Lysis Buffer (Promega) and the firefly and Renilla luciferase activity measured using the Dual Luciferase assay kit (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cell viability was assessed after 72 h with the CellTiter-Glo assay (Promega, G7573). Survival curves and area under the curve (A.U.C. ...
-
bioRxiv - Microbiology 2022Quote: ... and replication measured at 24 h intervals using Nano-Glo luciferase assay system (Promega). For inhibitor treatment the electroporated cells were seeded into replicate 24-well plates ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested for 18 h at 37 °C with 2 μg trypsin (Promega). After digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cell viability was determined 72 h upon drug exposure using CellTiter GLO (Promega) in a drug matrix screen at indicated concentrations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were digested for 16 h with trypsin (sequencing grade, Promega, Madison, Wisconsin, USA) at 37 °C in 50 mM ABC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Plates were read for a period of 24 h on the GloMax Discover (Promega) set to 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated for 72 h before assaying by OneGlo luciferase assay reagent (Promega). All plates included 8 wells of negative control siRNA (Ambion Silencer Select Negative Control #2) ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 h at 25 °C and digested with trypsin (Promega, 37 °C, overnight) in TEAB buffer (50 mM ...
-
bioRxiv - Biophysics 2024Quote: The fused peptide–mRNA was subsequently reverse transcribed using MMLV RT Rnase H-(Promega) for 1 h at 42 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pooled human male DNA (G3041, Promega and 4312660, Life Technologies) were used to generate calibration curves and serve as reaction controls ...
-
bioRxiv - Biochemistry 2020Quote: SETD2-HaloTag® human ORF in pFN21A was procured from Promega. Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Biochemistry 2020Quote: SETD2-HaloTag® human ORF in pFN21A was procured from Promega. Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human 26S proteasome purified from HEK293 cells was purchased from Promega. The proteasome chaperoning reaction tests were carried out as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... Human normal genomic DNA was obtained from Promega (Madison, WI, USA) and the values are averages of three replicates ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Cancer Biology 2020Quote: ... in a background of 130ng of normal human genomic DNA (Promega) was used as a positive control ...
-
bioRxiv - Cell Biology 2019Quote: ... and human samples were performed using GoTaq green master mix (Promega) and the following amplification conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 830bp or 800bp human STIM1 promoter into pGL3 basic vector (Promega) between XhoI and HindIII ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were allowed to grow for 120 h post-transfection prior to CellTiter Glo (Promega) analysis ...
-
bioRxiv - Cell Biology 2019Quote: ... Luminescence was assayed after 24-28 h using the Dual-Luciferase Reporter Assay System (Promega), with firefly luciferase normalized to the Renilla transfection control.