Labshake search
Citations for Promega :
251 - 300 of 6245 citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and resuspended in 500 µl of 1.25X Buffer H (Promega). A total of 7.5 μl of SDS 20% was added and incubated for 40 min at 65°C and then for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and reverse transcribed using M-MLV RNase H minus (Promega). cDNA products were purified on gel and amplified by PCR using the Phusion polymerase (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... 24 h later cells were transfected with Fugene HD (Promega) and constructs containing dCas9-VPR and gRNA vectors targeting the conserved DAR region (500ng plasmid DNA in molar ratios sgRNA:dCas9-VPR) ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was obtained using M-MLV H-reverse-transcriptase (Promega) with a dT17 primer ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction of samples was performed according to an adapted version of the “DNA purification from human feces using the Maxwell® RSC instrument and the Maxwell® RSC PureFood GMO and Authentication Kit” developed by Promega (Promega Corporation ...
-
bioRxiv - Microbiology 2022Quote: The extent of ADCC activation induced by human γ-globulins was evaluated with the use of an ADCC Reporter Bioassay (Core Kit; Promega, G7010) and the EnSpireMultimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... benthamiana leaves were collected at 48 h after infiltration and then incubated with 1 mM luciferin substrate (catalog no. N1110; Promega Biotech, Beijing, China). LUC images were captured with a Tanon-5200 Multi Chemiluminescent Imaging System (Tanon ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was synthesized using 1 µg of purified RNA and Promega M-MLV RNase H Minus Point Mutant Reverse Transcriptase (Promega, Madison, WI M3682) using the manufacturer’s recommended protocol for oligo dT-primed synthesis ...
-
bioRxiv - Cell Biology 2021Quote: Isolated protein aggregate fraction was solubilized for 1 h at room temperature with the use of 10 µl 0.1 % ProteaseMAX™ surfactant (Promega, cat. no. V2072) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using 1 µg of purified RNA and Promega M-MLV RNase H Minus Point Mutant Reverse Transcriptase (Promega, Madison, WI M3682) using the manufacturer’s protocol for oligo dT-primed synthesis ...
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Cell Biology 2020Quote: ... and M-MLV Reverse Transcriptase (RNase H Minus, Point Mutant; Promega). Quantitative (q)RT-PCR reactions for target genes were prepared using specific primer (Oligomer ...
-
bioRxiv - Immunology 2019Quote: ... and the luminescence after incubation with 5 µM coelenterazine H (Promega) were recorded using a Mithras LB940 reader (Berthold).
-
bioRxiv - Microbiology 2021Quote: ... 48 h later cells were lysed with reporter lysis buffer (Promega) and assays were read on a FLUOstar Omega plate reader (BMF Labtech ...
-
bioRxiv - Microbiology 2022Quote: ... 48 h later cells were lysed with reporter lysis buffer (Promega) and assays were read on a FLUOstar Omega plate reader (BMF Labtech ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNAs were reverse-transcribed using MMLV H(-) Point reverse transcriptase (Promega). Quantitative PCR was performed using the QuantiNova SYBR Green PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... template RNA was degraded by adding 2.5 U RNase H (Promega,) and 1µg RNase A (Pharmacia ...
-
bioRxiv - Cancer Biology 2019Quote: ... Viability was assayed 72 h after plating using CellTiter-Glo (Promega).
-
bioRxiv - Immunology 2020Quote: ... Infectivity was determined 72 h later by adding Bright-Glo (Promega) and measuring luciferase activity using a Synergy H1 plate reader (BioTek).
-
bioRxiv - Molecular Biology 2023Quote: Luciferase activity was analyzed 48 h post-transfection using DualGlo (Promega), essentially as previously described (25) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Moloney Murine Leukemia Virus Reverse Transcriptase RNase H-Point Mutant (Promega) was used for cDNA synthesis ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Biophysics 2020Quote: ... samples were blocked in 20% normal goat serum (NGS) for 1 h and incubated with the HaloTag® Biotin Ligand (Promega, 200-fold dilution) in PBS supplemented with 5% NGS overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were blocked in 20% normal goat serum (NGS) for 1 h and incubated with the HaloTag® polyclonal anti-rabbit (Promega, 100-fold dilution) in PBS supplemented with 2% NGS overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted with ABC to a final concentration of 1 M urea and digested using trypsin (Promega, V5113; 3 μg/mL, 37°C, 16 h). After digestion ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...