Labshake search
Citations for Promega :
251 - 300 of 764 citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: We performed a Cbl-b cellular thermal shift assay (CETSA) using NanoLuc split luciferase technology (Promega). HEK293T cells were plated in 6-well plates (4e5 cells/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription was performed on 1 μg of RNA with random hexamer primers using MMLV-RT enzyme (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments with lengths is above 500 bp to 2 kb were carried out with GoTaq enzyme (Promega) according to standard protocols ...
-
bioRxiv - Biochemistry 2020Quote: ... aliquots of the enzyme were removed from the freezer and were treated with thrombin (0.1 kU/mL, Promega) overnight at 4 °C in enzyme storage buffer (20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... The reverse transcriptase enzyme M-MLV RT (H-) (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H minus, Promega) was then used to transcribe 1 µg of total RNA to cDNA using Oligo(dT)15 primers (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and PERP plus any interacting proteins were cleaved from the resin using 30 units of ProTEV enzyme (Promega) at room temperature for one hour (elution 1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 μl 5x PNK pH 6.5 buffer [350 mM Tris-HCl pH 6.5, 50 mM MgCl2, 5 mM DTT], 1 μl PNK enzyme [NEB], 0.5 μl RNasin [Promega] ...
-
bioRxiv - Developmental Biology 2019Quote: ... This yielded a PCR product of 243 base pairs which is digested with restriction enzyme Bcl1 (Promega, R6651) in the presence of the G>A point mutation (i.e ...
-
bioRxiv - Plant Biology 2020Quote: ... Free UDP was measured as a proxy for reaction progress using the UDP-Glo enzyme assay kit (Promega) (Zegzouti et al. ...
-
bioRxiv - Immunology 2020Quote: ... The IKKα/β kinase activity in the IP complex was tested by using IKKβ Kinase Enzyme Kit (Promega) and following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The infection was measured by assaying activity of intracellular luciferase enzyme by using nano-go luciferase system (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were digested in 100 mM ammonium bicarbonate containing 2 μg of trypsin/Lys-C enzyme mix (Promega) at 37 °C overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... After that pancreatic enzyme was added at a ratio of 1:50 (Trypsin Gold, Promega, Fitchburg, WI, USA), and incubated overnight at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: Messenger RNA (mRNA) was generated for each chimeric Lep gene using the RiboMAX SP6 kit (Promega, Madison, WI). Lep variants were then translated using rabbit reticulocyte lysate (Promega ...
-
bioRxiv - Biochemistry 2021Quote: Linear DNA templates were generated by PCR using appropriate primers and transcribed into mRNA with T7 polymerase (Promega). In vitro translation was performed in rabbit reticulocyte lysate (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... Lep proteins were then produced from mRNA by in vitro translation using rabbit reticulocyte lysate (Promega, Madison, WI) supplemented with canine pancreatic rough microsomes (tRNA probes ...
-
bioRxiv - Developmental Biology 2023Quote: ... mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B) after plasmid linearization with Not1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-PCR for mRNA transcripts was performed by using the ImProm-II Reverse Transcription System kit (Promega A3800). Real Time PCR was performed with Applied Biosystems Fast SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Undigested bands from the restriction enzyme digestion were purified and cloned into the pGEM-T easy vector (Promega, USA) or using Zero Blunt™ TOPO™ PCR Cloning Kit (Invitrogen™ ...
-
bioRxiv - Microbiology 2021Quote: ... and Tat-dependent increase of luciferase enzyme activity in cell lysates was determined with the Luciferase Assay system (Promega). Luminometric activity was analyzed with a Mithras luminometer.
-
bioRxiv - Microbiology 2020Quote: ... Standard procedures for DNA digestion and ligation were used in conditions recommended by the enzyme manufacturer (Promega or Fermentas). All DNA sequencing was carried out by Beckman Coulter or Eurofins Genomics.
-
bioRxiv - Microbiology 2019Quote: ... PCR fragments together with pEGFP-N2 plasmid were then digested with EcoRI and XmaI restriction enzymes (New England Biolab) according to manufacturer’s protocol and ligated using T4 ligase (Promega). The resulting constructs were sequenced to ensure that no other changes had occurred prior transformation into XL10-Gold E.coli (Agilent).
-
bioRxiv - Zoology 2020Quote: ... 0.2 μl of Acetylated BSA at 10 μg/μl and 0.5 μl of 10 U/μl restriction enzyme Alu I (Promega), 12.3 μl of DNase-free water and 5 μl of PCR products ...
-
bioRxiv - Molecular Biology 2022Quote: ... The in vitro kinase assay was performed using the Cyclin A2/Cdk1 Kinase Enzyme System (Promega, Madison, WI, USA), recombinant Cyclin B1/Cdk1 (SignalChem Biotech Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 250 ng of DNAsed RNA were retro-transcribed using random hexamer primers with the M-MLV-RT enzyme (Promega). cDNA were amplified with the GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... One blot was incubated at 37°C for 2h with 10mL CIAP buffer (100mM NaCl, 10mM MgCl2, and 50mM Tris-HCl pH 7.9) containing 1000 units CIAP enzyme (Promega) and the other blot was incubated with CIAP buffer without CIAP enzyme ...
-
bioRxiv - Biochemistry 2023Quote: ... each sample was digested overnight at 37 °C with one or more of the following enzymes separately: trypsin (Promega), Lys-C (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... Two μL of reverse transcription buffer 5X were added and the samples were incubated at 20°C for 15 min before addition of 1.5 μL of dNTP mix (1 mM of dATP, dGTP, dCTP, dUTP) and 1 μL of AMV enzyme (PROMEGA). Reverse transcription was performed at 42°C for 45 min and synthesized cDNA was recovered by ethanol precipitation as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA samples (from three independent plants in all cases) were subjected to reverse transcription with the AMV enzyme (Promega) and random hexanucleotides as primers ...
-
bioRxiv - Biochemistry 2022Quote: ... The splicing substrate XBP1u mRNA was prepared using a RiboMAX™ Large Scale RNA Production Systems—T7 kit (Promega) at 37°C for 3 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... CspA was allowed to bind cspA mRNA in 40 µL of Buffer N by incubating 10 pmoles of renatured mRNA with the indicated amounts of protein CspA in the presence of 0.4 U/µL of RNasin (Promega). After 15 min at 15°C ...
-
bioRxiv - Bioengineering 2021Quote: mRNA pools were prepared by in vitro transcription using the RiboMAX Large Scale RNA Production System-T7 (Promega, USA), and prepared DNA templates ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1μg of mRNA was reverse-transcribed using oligo-dT-VN primers and ImProm-II as the reverse transcriptase (Promega) in triplicate ...
-
bioRxiv - Molecular Biology 2022Quote: ... The mRNA at a concentration of 214 ng/µL was translated in the Flexi Rabbit Reticulocyte Lysate System (Promega) for 25 minutes at 32°C resulting in run-off ribosome nascent chain complex (RNC) ...
-
bioRxiv - Microbiology 2022Quote: The HEV replicon plasmids were linearised with BglII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: pSK-E2-nLuc replicon plasmid was linearised with BglII and pUC-HEV83-2 replicon plasmid was linearised with HindIII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... All mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B).
-
bioRxiv - Cancer Biology 2024Quote: ... The identity of each cell line was confirmed by DNA fingerprinting via short tandem repeats at the time of mRNA and total protein lysate preparation using the PowerPlex 1.2 kit (Promega).
-
bioRxiv - Cell Biology 2024Quote: mRNA was synthesized in vitro with linearized template plasmids using the RiboMax Large Scale RNA Production System-T7 (Promega) supplemented with the Ribo m7G Cap Analog (Promega) ...
-
bioRxiv - Immunology 2019Quote: ... NF-κB activity experiments were conducted using βTC3 cells transfected with 0.3 μg of the NF-κB.Luc reporter (Promega) and 0.25 μg CMV.β-galactosidase (a kind gift from Beth Israel Harvard Medical School ...
-
bioRxiv - Immunology 2023Quote: ... B lymphocyte proliferation was measured using the cell proliferation assay kit (CellTiter 96 Aqueous) from Promega (Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... or gels where Arm A and Arm B ran together) before staining with Diamond Nucleic Acid Stain (Promega) for 20 minutes ...
-
bioRxiv - Genomics 2020Quote: ... a sequence containing two miR-1 target sites was excised from pAG76 (20) using restriction enzymes SacI and XbaI and inserted into pmirGLO Dual-Luciferase vector (Promega) using restriction enzyme sites for SacI and XbaI (sequence for miR-1 sites in Supplementary Table S3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Liberibacter OmpA was amplified using SgfI and PmeI restriction sites (Table 1) and was digested using Flexi Enzyme Blend (Promega). Similarly ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The extracted RNA was quantified using Nanodrop spectrophotometer (ThermoScientific, USA) and reverse transcribed using MMLV reverse transcriptase enzyme (Promega, USA) and oligo d(T)15 primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Infected cell death was quantified by the release of the cytosolic enzyme LDH into the culture supernatant at 24h post-infection using the CytoTox-ONE Homogeneous Membrane Integrity Assay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... Inverse PCR reactions were carried out with 2 μL of DNA solution in a final volume of 20 μL using the GoTaq enzyme (Promega). The PCR conditions were as follows ...