Labshake search
Citations for Promega :
2701 - 2750 of 5281 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of the purified RNA was further treated in solution by 5 units of RQ1 DNase in 100 μl of 1x RQ1 buffer (Promega) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole mount in situ hybridization was performed as previously described 55 with the following modifications: 5 dpf larvae were permeabilized by digesting with Proteinase K (10ug/ml, Promega) for 2 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... and rehydrated with 5 μL of digestion solution containing 20 mM ammonium bicarbonate and 15 ng/μL sequencing grade trypsin (Promega). Digestion was carried out at 37°C for 6 h ...
-
bioRxiv - Cell Biology 2020Quote: ... and the proteins were on-bead digested using 5 µl of Sequencing Grade Trypsin (100 ng/µl in 10 mM HCl, Promega). The digestion was carried out at 37°C over night ...
-
bioRxiv - Microbiology 2021Quote: ... where the multiple cloning site had been replaced by a synthetic construct (Genewiz) composed of a 5’ HiBiT tag (Promega), a new multiple cloning site and 3’ 3xHA tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... was added to the plate and incubated at room temperature for 5 min before measuring luminescence on a GloMax 96 luminometer (Promega).
-
bioRxiv - Immunology 2022Quote: ... for 48 hours after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... total RNA was extracted separately from two 5 mg crushed-tissue samples by using the SV Total RNA Isolation System (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... in vitro translated hnRNP M protein fragments (5 μl) produced by rabbit reticulocyte lysate using TNT Quick Coupled Transcription/Translation Systems (Promega). Proteins were incubated at 4°C for 2 hours in the binding buffer above ...
-
bioRxiv - Developmental Biology 2019Quote: ... Stellaris® DNA probes were gently resuspended in 95 µl fresh TE buffer and 5 ul RNAse inhibitor (RNAsin Plus RNase Inhibitor, Promega), and frozen at −80 °C in 10 µl aliquots ...
-
bioRxiv - Genetics 2020Quote: ... double-stranded DNA oligos containing KRAB-ZFP target sequences (Supplemental Table 5) were cloned upstream of the SV40 promoter of the pGL3-Promoter vector (Promega) between the restriction sites for NheI and XhoI ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were grown in 5 mL LB medium overnight and plasmid DNA was isolated using the PureYield Plasmid Miniprep System (Promega). The plasmids were further tested by a restriction enzyme digestion analysis ...
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... at pH 8 and subjected to reductive alkylation (using 15 mM iodoacetamide and 5 mM DTT) and methanol/chloroform extraction followed by digestion with sequencing-grade Trypsin (Promega) overnight at 37°C.Tryptic peptides were desalted and analyzed by liquid chromatography tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Immunology 2021Quote: ... The mixture was subsequently incubated with 293TAce2 cells for 48 h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... For SlTPD1 a 284 bp DNA fragment from the 5’ coding region was amplified by PCR using cDNA from flowers and cloned into the pGEM-T Easy vector (Promega). For TomA5B and SlSDS genes ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from approximately 5×105 cells using the ReliaPrepTM RNA Cell Miniprep System (Promega, UK, Cat. Z6012) following product guidelines ...
-
bioRxiv - Immunology 2020Quote: ... At 48 h later the cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Immunology 2021Quote: ... extensively washed to remove unbound virus and co-cultured with Huh7.5 for 5 days at 37°C after which they were analyzed for with the Luciferase assay system (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 5) in the presence or absence of 20 µM z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Flies were placed individually in 100 ul Chelex solution (5g of Chelex mixed with 95ml TE buffer) with 5 ul proteinase K (Promega), and incubated overnight at 56°C ...
-
bioRxiv - Immunology 2022Quote: ... or HT1080/Ace2 cl14 cells (for all variant neutralization assays) for 48 hours after which cells were washed with PBS and lysedwith Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysateswas measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Kinase activity of phosphorylated CDK2 with cyclin A and varying amounts of inhibitor (dinaciclib or 5) were measured using the ADP-Glo Kinase Assay (Promega) in a luminescence plate reader (Tecan Infinite M1000 PRO) ...
-
bioRxiv - Neuroscience 2022Quote: ... Flag-tagged STAU1 or STAU1RBDΔ3 or Flag plasmids with the wildtype or mutant 5’UTR-MTOR-LUC or luciferase empty vector constructs and Renilla luciferase plasmid (pRL-SV40 vector, Promega) according to an experimental set-up ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM MgCl2, 1.5 mM KCl, 100 μ g/ml cycloheximide, 1mM DTT, 200 U/ml RNase in from Promega, 0.5% Sodiumdeoxycholate ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested overnight (18 hours) with a Trypsin+LysC mixture (Promega) at a protein to protease ratio of 25:1 ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... To quantify the activity of reports groups of 5 embryos were collected 8 hours post-injection in triplicates and lysed in 100 mL of lysis buffer (Promega). Reporter expression was quantified with the Nano-Glo Dual-Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were treated 24h after seeding and cell viability was assessed 5 days after treatment using the Cell Titer-Glo luminescent cell viability assay (Promega). Cells treated with vehicle control DMSO (0.1% ...
-
bioRxiv - Neuroscience 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Biophysics 2024Quote: ... was incorporated at the 5’ end of the FL open reading frame during PCR amplification from a pRL-CMV vector (Promega). A Kozak consensus sequence and a 50-nucleotide upstream region was incorporated before the translation start site to ensure enough space for the assembly of translation initiation complex77 ...
-
FACS-Sortable Picoreactors for Ultra High-throughput Screening of Catalysts in Biphasic EnvironmentsbioRxiv - Bioengineering 2024Quote: ... emulsions of octanol + 5% (w/v) Span 80 + 40 µM Nile Red in an aqueous phase of nuclease free water (Promega) + 200 ng/µL miniprepped plasmid + 5% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μL of Nano-Glo HiBiT Lytic Detection Reagent was added directly to the cells and incubated for 5 min on an orbital shaker (300 rpm) before recording luminescence on a GloMax Discover (Promega) with 0.2 s integration time.
-
bioRxiv - Microbiology 2022Quote: ... and alkylated with 5 mM of iodoacetamide 30 min in the dark at RT°C prior to digestion with 5 μg of trypsin Gold (Promega) for 15 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 before measurement of Renilla and Firefly luciferase activities using Dual-Glo® Luciferase Assay System (Promega, Cat #E2920) and Tecan SPARK plate reader ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Microbiology 2023Quote: The RNase III.RNA complexes were washed and the 5′ ends of bound RNAs were dephosphorylated with the addition of thermosensitive alkaline phosphatase (Promega). RNA was radiolabelled by phosphorylation with T4 PNK (Sigma-aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...