Labshake search
Citations for Promega :
2301 - 2350 of 5641 citations for ssc mir 411 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Gene-specific and transposon multiplex primer PCR was performed under standard conditions with 2X GoTaq Green Master Mix (Promega) with 5% DMSO (v/v).
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... The expression of reporter and reference genes were analyzed by quantitative PCR using GoTaq-qPCR Master Mix (Promega, #A6002), with the real-time PCR system (Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega, #M7845) in the standard 25µl reaction following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of NanoLuc was amplified by PCR using the primers 5-NanoL and 3-NanoL from pNL1.1.CMV plasmid (Promega). The resulting fragment was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 digested with the same enzymes ...
-
bioRxiv - Plant Biology 2024Quote: ... The GmPGIP amplicons were purified by the Wizard® SV Gel and PCR Clean-Up System and protocol (Promega). GmPGIP amplicons were ligated directionally into the pENTER/D-TOPO vector and protocol (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 μl per sample resulting from PCR were mixed with Blue/Orange loading buffer loading dye 6x (PROMEGA, G190A) and loaded onto gel ...
-
bioRxiv - Physiology 2024Quote: The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well ...
-
bioRxiv - Microbiology 2020Quote: ... lactate and pyruvate were detected using Pyruvate Colorimetric/Fluorometric Assay kit (Biovison) and Lactate-Glo™ Assay kit (Promega).
-
bioRxiv - Microbiology 2022Quote: ... Dual Luciferase reporter assay kit and CellTiter96 Aqueous one solution cell proliferation assay kits were from Promega (Madison, USA). Non-targeting siRNA (Catalog no ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Genomics 2020Quote: DNA was extracted from the fin clips of the challenged fish using a commercial kit (Wizard Genomic DNA Purification Kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA from Legionella was isolated using the Wizard Genomic DNA Purification Kit or the Maxwell DNA extraction kit (Promega). Plasmids from L ...
-
bioRxiv - Genomics 2019Quote: ... The genomic DNA and total RNA were extracted from cells using the Maxwell 16 Cell LEV DNA Purification Kit and the Maxwell 16 Cell LEV Total RNA Purification Kit (Promega), respectively.
-
bioRxiv - Molecular Biology 2019Quote: ... collected by scraping and lysed in the buffer provided by the Nucleospin RNA isolation kit (Mackerey-Nagel) or the Reliaprep miniprep kit (Promega). RNA was isolated according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded (FFPE) tissue slides using Maxwell® RSC Blood DNA Kit and Maxwell® RSC RNA FFPE Kit (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2022Quote: ... purified with a NucleoSpin® Gel & PCR Clean-up kit (Machery-Nagel) and radiolabeled dCTP-P32 were incorporated with a Prime-a-gene Labeling System kit (U1100, Promega). Oligonucletotide probes were ordered from GenoScreen and radiolabeled dATP-P32 were incorporated with a T4 Polynucleotide Kinase kit (T4 PNK EK0031 ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from FACS purified iPSC-neurons and frozen mouse brain tissue using the ReliaPrep RNA cell kit and ReliaPrep RNA tissue extraction kit (Promega) respectively.
-
bioRxiv - Microbiology 2024Quote: ... difficile was mixed with 50 µL kit reagents (100-fold diluted LgBiT protein, 50-fold diluted substrate in kit buffer, Promega). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... gallolyticus genomic DNA was extracted using either Wizard Genomic DNA Purification Kit or Wizard SV Genomic DNA Purification Kit (Promega). The extraction was performed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were extracted using a standard Qiagen Miniprep kit and genomic DNA (gDNA) was extracted using a standard Wizard DNA Extraction Kit (Promega) and all DNA was quantified using a Qubit ...
-
bioRxiv - Immunology 2024Quote: ... CellTiter-Glo luminescent cell viability assay kit (G7570) and CytoTox 96 non-radioactive cytotoxicity assay kit (G1780) were purchased from Promega.
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was then amplified with the GenomiPhi V2 DNA Amplification Kit (Cytiva Life Sciences) and again quantified using the Quantus Fluorometer and QuantiFluor dsDNA Kit (Promega). Illumina DNA Prep (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (qPCR) was performed with the primers listed in Table S1 and a GoTaq qPCR Master Mix (Promega, A6002) in a Mastercycler realplex2 thermocycler (Eppendorf) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of DNA was taken as template in a 25 μl PCR reaction using the Go Taq DNA polymerase (Promega) according to the provider’s recommendation ...
-
bioRxiv - Developmental Biology 2021Quote: ... fragment of Snai2 coding sequence (from nucleotides 165 to 971) was PCR-amplified from quail cDNA and cloned in pGEM-T Easy vector (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... Mtfp1 and Gnpat 3’UTRs and Tnksbp1 and Gnpat CDS were amplified by PCR from MIN6 cDNA and subcloned into pmirGLO (Promega), downstream the Firefly ORF ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the desired bands were recovered from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega). Finally ...
-
bioRxiv - Developmental Biology 2021Quote: ... the proximal promoter region (−299/−1) of MyoG was isolated by PCR and inserted into the pGL3-basic vector (Promega). The DNA fragments of PME1 and PME2 in the MyoG promoter region were also amplified and inserted into the pGL3-γ-actin-TATA vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... and random hexamers were used for reverse transcription and PCR amplification was carried out using 25 cycles and GoTaq polymerase (Promega) with linker specific primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... ATFS-11-100(R/R)::GFP and Su91-69::GFP) were synthesized in reticulocyte lysate in the presence of [35S]methionine (T7 Quick for PCR DNA, Promega). Import into isolated mitochondria was performed in import buffer (3 % (w/v ...
-
bioRxiv - Molecular Biology 2021Quote: Viral RNA was extracted from 0.2 mL of cobas PCR Media using Maxwell® 16 instrument (Promega, Madison, WI, USA) for final elution in 30μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... the genomic DNA from all KO cell lines was extracted and the region flanking the Cas9 target site from each ΔPUS cell line PCR amplified and cloned into the EcoRI and HindIII sites of pGEM-3zf vector (Promega). The primers used to amplify the region flanking the Cas9 target sites were the following ...
-
bioRxiv - Molecular Biology 2021Quote: A conventional PCR targeting the hsp65 gene was conducted using the GoTaq® Green Master Mix (Promega, Madison, Wisconsin, USA) in a final reaction volume of 13μl comprising 6.25μl of 2X GoTaq Hot Start Green Master Mix ...
-
bioRxiv - Cell Biology 2020Quote: ... Generated WIP1 and WIP1-ΔκB promoter PCR products were cloned into pGL3-basic luciferase reporter vector (Promega, Madison, WI, USA) using XhoI and BglII restriction enzyme sites and designated as pGL3-WIP1 and pGL3-WIP1-ΔκB ...
-
bioRxiv - Microbiology 2019Quote: For all qRT-PCR reactions 1µg of total RNA was treated with DNase using RQ1 RNase-free DNase (Promega, USA) and transcribed into cDNA (RevertAid First Strand cDNA Synthesis Kit ...
-
bioRxiv - Developmental Biology 2019Quote: A 604bp in situ probe for desmogon was generated from total cDNA of stage 33 medaka embryos by PCR using the following primers fwd: TTCTGCGAGATCAGGCTCAC rev: AAGGCCCCTCCTCTGTAACT and subsequently A-tailed and cloned into a PGEMTeasy vector (Promega). Sense and anti-sense probes were generated using Sp6 and T7 polymerases (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: Expected products of SDDV ATPase fragment amplification (135 bp) obtained from the above PCR assays were cloned into pGEM-T easy vector (Promega) and transformed into E ...
-
bioRxiv - Microbiology 2019Quote: ... coli HT115 gadA gene was amplified by PCR using primers NgadAFw and NgadARw with Taq polymerase and cloned in the pGemT Easy plasmid (Promega) according to manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2019Quote: ... 40 μL of supernatant was then transferred from each sample to PCR strip tubes and mixed with 10 μL Renilla luciferase lysis buffer (Promega). Prepared samples were then stored at −20°C until luciferase assays were run ...
-
bioRxiv - Biophysics 2019Quote: ... the same DNA was combined with a PCR fragment amplified from cZP1full/pGEM57 to generate a 6His-tagged full-length cZP1 ORF in pSI (Promega). The pHLsec3 construct expressing C-terminally 6His-tagged mZP1-N1M1-A141 was generated by PCR ...
-
bioRxiv - Microbiology 2019Quote: ... The linear amplification product was purified using the Promega Wizard SV Gel and PCR Clean-up System (Promega Corporation, A9282), and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S) ...
-
bioRxiv - Cell Biology 2019Quote: A cDNA fragment corresponding to nt995-1537 of mouse trip6 cDNA (GenBank accession number NM_011639.3) was generated by PCR and subcloned into the pGEM-T Easy Vector (Promega, Madison, WI). Radiolabeled riboprobes were generated by using [35S]UTP (Hartmann Analytik ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The allelic frequencies of the long and short alleles in the northern Queensland population were found by taking 14 samples of 56 to 92 flies and individually PCR genotyping all flies in the sample using GoTaq (Promega). Primer sequences ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice were genotyped by extracting DNA from tail clippings with Extracta DNA Prep for PCR – Tissue (Quanta Biosciences) and specified products amplified using either GoTaq Green Mastermix (Promega) or 2x KAPA buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... Genomic regions flanking the CRISPR target sites were PCR amplified with designed primers (Supplemental Table 3) using GoTaq DNA polymerase (Promega) and sent for Sanger sequencing to determine the insertion and deletion errors generated by CRISPR-Cas9 system in exon 2 of PARKIN ...
-
bioRxiv - Biochemistry 2020Quote: ... or ∼30 ng (Proevolidine and Proxanthoxycyclin E gDNA) of the A-tailed PCR product were ligated into 50 ng of the pGEM-T Easy vector (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was probed with a 400 bp 32P-labelled PCR product of the TbCls 3’UTR generated with the prime-a-gene labelling system (Promega). Primers used for PCR were ...
-
bioRxiv - Bioengineering 2020Quote: ... The second round of PCR was run with 10μL GoTaq Green Master Mix (Promega Biosciences LLC, San Luis Obispo, CA), 4.2μL of water ...