Labshake search
Citations for Promega :
2401 - 2450 of 5641 citations for ssc mir 411 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Approximately 100bp of the surrounding sequence was amplified by PCR from LX2 cells and cloned into the XhoI site of the pGL3+promoter vector (Promega) with corresponding empty vector as control ...
-
bioRxiv - Cell Biology 2020Quote: ... −2784 bp from the start codon to +688 bp from the stop codon) was amplified from Arabidopsis genomic DNA by PCR and integrated into pGEM-T Easy vector (Promega). First ...
-
bioRxiv - Plant Biology 2021Quote: ... For SlTPD1 a 284 bp DNA fragment from the 5’ coding region was amplified by PCR using cDNA from flowers and cloned into the pGEM-T Easy vector (Promega). For TomA5B and SlSDS genes ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’ GA CTC GAG GTT GCA CCT AGT GGA T 3’ The PCR product was first cloned into pGEM-T easy vector (Promega), verified by sequencing and subsequently cloned into pGEX5.1 vector using the EcoRI and XhoI sites ...
-
bioRxiv - Evolutionary Biology 2020Quote: To generate the pGl3-STK38-P luciferase reporter,1.2 kb of DNA upstream the STK38 TTS promoter region with ZNF611 binding motif was amplified by polymerase chain reaction (PCR) and cloned into the Firefly luciferase reporter plasmid pGL3-Basic (Promega) using KPN1 and XHO1 restriction sites.0.7 kb of DNA upstream the STK38 TTS promoter region without ZNF611 binding motif was cloned into pGL3-Basic using same restriction sites to generate the pGl3-STK38-ΔP luciferase reporter ...
-
bioRxiv - Genetics 2021Quote: ... Bands purification were made with Wizard® SV Gel and PCR Clean-Up System (Promega, 2800 Woods Hollow Road·Madison, USA). Next ...
-
bioRxiv - Genetics 2021Quote: ... 3ul of gel extracted PCR product was used for TA cloning with the pGEM-T Easy Vector System (Promega, A1360) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR products and restriction enzyme digestions were purified by agarose gel electrophoresis followed by processing with the Wizard SV Gel and PCR clean up system (Promega). Restriction enzymes were purchased from Fermentas ...
-
bioRxiv - Microbiology 2020Quote: ... The genomic region flanking the Cas9 target site from each ΔNAT10 cell line was PCR amplified and cloned into the XbaI/SalI sites of pGEM-3zf+ vector (Promega). 10+ bacterial cell clones of pGEM-genomic-region-plasmid from each CRISPR-knockdown cell clone were isolated for Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... the coding sequence of REST/NRSF ZF1-8 were amplified by PCR using cDNA as templates and cloned into the pTNT vector (Promega) between the EcoRI and XbaI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’UTR PCR products were directionally cloned downstream of the Renilla luciferase open reading frame (ORF) of the psiCHECK2 vector (Promega) that also contains a constitutively expressed firefly luciferase gene ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 μL of cDNA was used for 25 μL PCR reactions using the GoTaq Hot Start Master Mix (Promega). Cycling parameters consisted of an initial denaturation of 95°C for 2 min. ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genome editing efficiency was checked by PCR on genomic DNA from the transfected population with the GoTaq G2 polymerase (Promega) using primers surrounding the 210 bp deleted region ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pups were screened for the deletion by classical genotyping PCR with the GoTaq R2 Hot Start Green Master Mix (Promega) with fw (5’-CCTCGGAAGCTGCCTAAGAT-3’) ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Microbiology 2022Quote: ... Further taxonomic affiliation was carried out on these clones after PCR amplification of the rDNA genes using the same primers as above and Pfu DNA polymerase (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR fragments were purified over gel and the DNA was recovered using the Wizard SV Gel and PCR Clean-Up System (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were purified on a 1% agarose gel and ligated into a pGEM-T Easy Vector Systems (Promega) plasmid followed by transformation in E ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR products were visualized using agarose gel electrophoresis and subsequently cloned into a pGEM-T easy cloning vector (Promega, Australia). Blue/white colonies were screened using standard techniques and a test digestion with endonuclease restriction enzyme EcoR1 was carried out to confirm insertion ...
-
bioRxiv - Neuroscience 2022Quote: ... Templates for RNA FISH probes were amplified by PCR from genomic DNA (Table S3) and cloned into pGEM-T Easy (Promega) or pCRII-TOPO ...
-
bioRxiv - Microbiology 2024Quote: ... and the resulting products were checked on agarose gel (1%) and purified using the Wizard SV Gel and PCR Clean-Up System (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... using oligo (dT) as a primer and quantitative PCR analysis was performed using the GoTaq qPCR SYBR master mix (Promega) on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Biophysics 2024Quote: ... was incorporated at the 5’ end of the FL open reading frame during PCR amplification from a pRL-CMV vector (Promega). A Kozak consensus sequence and a 50-nucleotide upstream region was incorporated before the translation start site to ensure enough space for the assembly of translation initiation complex77 ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Microbiology 2024Quote: ... Kanamycin-sensitive exconjugants were screened for the mutant with colony PCR using altgenoF and altgenoR primers designed outside of the deletion flanks with the following PCR reaction mix: 10 µl of GoTaq Green master mix (Promega), 0.5 µl of each primer at 10 µM concentration ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of extracted DNA was added to an amplification mixture containing 1 µl (10 µM) of primers and 12.5 μl of PCR Master Mix Plus (Promega, USA). To each mixture ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resultant PCR products were subsequently subjected to purification through agarose gel electrophoresis employing the Wizard Sv Gel Clean-up system (Promega). Following purification ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The extracted plasmid was linearized by SalI digestion and purified using the Wizard SV PCR cleanup system (Promega, Madison, WI). SMRT sequencing was performed using Sequel IIe (Pacific Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... the Deaf1 promoter region was first PCR-amplified from genomic DNAs of C2C12 mouse myoblasts and cloned into the pGL4.20 vector (Promega, E675A). ...
-
bioRxiv - Cell Biology 2024Quote: ... Deletion mutants of Caskin2 and Caskin2-4A were generated by site-directed mutagenesis with the PCR-based overlap extension method using Pfu DNA polymerase (Promega), and fragments containing the different mutations were exchanged with corresponding fragments in the pUC19-CASKIN2-GFP plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primers were used to amplify PCR products which were used to generate in situ hybridization probes with T7 RNA polymerase (Promega) and Digoxigenin-UTP (DIG RNA Labeling Mix ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplicons were separated by electrophoresis and the corresponding bands were purified with the Wizard SV Gel and PCR Clean-Up System (Promega) kit ...
-
bioRxiv - Immunology 2024Quote: ... miiuy MDA5 gene was amplified using PCR with the gene-specific primers and ligated into a pmir-GLO luciferase reporter vector (Promega). Meanwhile ...
-
bioRxiv - Microbiology 2024Quote: ... named rpsL*) was amplified by PCR with primers BlD-LLcfusARpsL/BlD-LLldacARpsL and cloned into the pGEM-T Easy vector (Promega), yielding plasmid pGEM-rpsL* ...
-
bioRxiv - Cell Biology 2024Quote: Genotyping was performed by PCR in 20 µl volume reactions that included 1x GoTaq Green Mas-ter Mix (Promega #M7123), 1.1 mM MgCl2 ...
-
bioRxiv - Microbiology 2024Quote: ... The master mix for the PCR reaction included 10 µL GoTaq Hot Start Green Master Mix (Promega, Madison, WI US), 2 µL of each primer at 10 µM ...
-
bioRxiv - Microbiology 2024Quote: The copy number of re-integrant strains was determined by extracting the genomic DNA and performing quantitative PCR (qPCR) using GoTaq polymerase (Promega) and a StepOnePlus real-time PCR machine (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... Double stranded RNA (dsRNA) was synthesized from purified T7-tagged PCR amplicons using the T7 RiboMax Express Large-Scale RNA production system (Promega) according to the manufacturer’s instructions and purified as previously described [33] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Next two overlapping fragments containing one of the homologies and a part of the antibiotic marker were generated by PCR using Taq polymerase (Promega), which overlap for a length of 594 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by extracting DNA from tail clippings with Extracta DNA Prep for PCR—Tissue (Quanta Biosciences) and specified products amplified using either GoTaq Green Mastermix (Promega) or 2x KAPA buffer ...
-
bioRxiv - Microbiology 2023Quote: ... gondii glyceraldehyde 3-phosphate dehydrogenase 2 (GAPDH2, ML5049/ML5680) or TgAPT1 (ML4097/ML4098) were used for subsequent PCR amplification with GoTaq polymerase (Promega) for twenty-five cycles as follows ...
-
bioRxiv - Microbiology 2023Quote: ... The kan gene was then inserted between the upstream and downstream 05515-05525 flanking PCR fragments and simultaneously inserted into the pGEM-7Zf vector (Promega) in the BamHI and XhoI sites using the In-Fusion kit according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the coding sequence of HIV-1 Nef (SF2 variant) was amplified by PCR and inserted into the plasmid pNLF-1-C (Promega) for expression of NanoLuc at the Nef C-terminus ...
-
bioRxiv - Microbiology 2023Quote: ... generated by cloning the entire coding sequence of mouse APOBEC1 (mAPOBEC1) amplified from mouse cDNA by PCR into pGEM-T-easy (Promega), and cloning it into the EcoRI and SalI sites of pEGFP-C2 (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: The HLB1 coding sequence corresponding to the N-terminal 200 amino acids was amplified by PCR using the following primers and was cloned into pGEM-T-easy vector (Promega). The NdeI and XhoI fragment of HLB11-200 was cloned into pET28a vector (Novagen ...