Labshake search
Citations for Promega :
2151 - 2200 of 5339 citations for ssc mir 411 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... These PCR products were subcloned downstream of the luciferase gene contained in the pGL3-Basic commercial vector (Promega – E1751). Mutation of the highly cross-species conserved miR-483-3p seed target sequence from AGGAGUG to AGGAACG (mouse ...
-
bioRxiv - Molecular Biology 2023Quote: The human MEOX1 enhancer syntenic to the mouse Meox1 peak9/10 enhancer3 fragment along with the mouse Il1b peak5 and peak6 fragments were PCR amplified and cloned into the XhoI and HindIII sites in the Firefly luciferase plasmid pGL4.23 (Promega) using the Cold Fusion kit (System Biosciences Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl cDNA of WT and CRISPR cln3 mutant lines was used as PCR template and amplicons were cloned into the pGEMT vector following the manufacturer’s instructions (Promega). Selected clones were sent for sequencing.
-
bioRxiv - Microbiology 2023Quote: ... The FAM-labeled probes were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, USA) and quantified with a NanoDrop 2000C (Thermo ...
-
bioRxiv - Microbiology 2023Quote: ... Each PCR product was digested with XhoI and BamHI and ligated with the T4 DNA ligase (Promega, Cat #: M1794) into a XhoI and BamHI pre-digested pcDNA3.1-mCherry-HIS vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20th of the resulting cDNA was used then analyzed by qRT-PCR using GoTaq qPCR master mix (Promega). The following primer pairs were used:
-
bioRxiv - Plant Biology 2023Quote: ... The size of the amplified PCR products was ascertained by utilizing a 100 bp GeneRulers™ DNA ladder (Promega). PCR products were sent to Genewiz/ Azenta company for DNA sequencing in both directions.
-
bioRxiv - Plant Biology 2023Quote: ... Gene-specific and transposon multiplex primer PCR was performed under standard conditions with 2X GoTaq Green Master Mix (Promega) with 5% DMSO (v/v).
-
bioRxiv - Neuroscience 2023Quote: Adult worms were lysed following standard protocols and PCRs were performed using GoTaq Green Master Mix (Promega, REF-M7123). Mutant alleles were distinguished from wild-type by imaging Restriction Fragment Length Polymorphisms (RFLP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1μl of the cDNA was used for PCR amplification reactions using using GoTaq® G2 DNA Polymerase (Promega, #M7845) in the standard 25µl reaction following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Approximately 100 ng of full-length PCR product was ligated into the pGEM-T Vector System (Promega, Madison, WI), at a 3:1 molar ratio of insert ...
-
bioRxiv - Microbiology 2023Quote: ... USA) was performed using primer 27F on a V1-V3 16S rRNA gene colony-PCR amplicon (GoTaq Green, Promega) of primers 27F and 519R ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Denaturated RNA (5μg) was retrotranscribed and used for quantitative PCR using GoTaq qPCR Master Mix according to the manufacturer’s instructions (Promega) at a dilution of 1/10 for mycelium and 1/7 for rice leaves ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified PCR products were in vitro transcribed using the T7 RiboMAX Express Large Scale RNA Production System (Promega, P1320). The transcripts were purified using the RNeasy Micro kit (QIAGEN ...
-
bioRxiv - Pathology 2023Quote: ... PCRs were performed in a final volume of 20 µL containing 1X of Colorless GoTaq® Flexi Buffer (Promega), 0.0625 mM of each dNTP ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Physiology 2023Quote: The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well ...
-
bioRxiv - Neuroscience 2023Quote: ... The expression of reporter and reference genes were analyzed by quantitative PCR using GoTaq-qPCR Master Mix (Promega, #A6002), with the real-time PCR system (Light Cycler 480 ...
-
bioRxiv - Cancer Biology 2023Quote: IDH1 and NNT promoter sequences were amplified from genomic DNA of human primary melanocytes by PCR and cloned into pGL4.12 (Promega). Mutagenesis of E-boxes was performed using a QuikChange Site-Directed Mutagenesis Kit (Stratagene) ...
-
bioRxiv - Neuroscience 2023Quote: ... For all animals universal PCR reaction was used as follows: 12.5 μl of GoTaq Hot Start Green Master Mix (Promega), 0.5 μl of each primer (25 μM ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was purified after migration on a 1% agarose TAE 0.5X gel using the Wizard PCR Clean-Up system (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA were purified using the Wizard® SV Gel and PCR Clean-Up System protocol (Promega, Madison, Wisconsin, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Purification and assembly of DNA fragments were performed using a Wizard SV Gel and PCR Clean-up System (Promega) and a NEBuilder HiFi DNA assembly cloning kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was digested with ApaI and XhoI and then purified (Wizard® SV Gel, Promega, WI, USA). The eluted fragment was ligated downstream of an inducible acetoacetate decarboxylase promoter (Padc ...
-
bioRxiv - Microbiology 2020Quote: ... lactate and pyruvate were detected using Pyruvate Colorimetric/Fluorometric Assay kit (Biovison) and Lactate-Glo™ Assay kit (Promega).
-
bioRxiv - Microbiology 2022Quote: ... Dual Luciferase reporter assay kit and CellTiter96 Aqueous one solution cell proliferation assay kits were from Promega (Madison, USA). Non-targeting siRNA (Catalog no ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Genomics 2020Quote: DNA was extracted from the fin clips of the challenged fish using a commercial kit (Wizard Genomic DNA Purification Kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA from Legionella was isolated using the Wizard Genomic DNA Purification Kit or the Maxwell DNA extraction kit (Promega). Plasmids from L ...
-
bioRxiv - Genomics 2019Quote: ... The genomic DNA and total RNA were extracted from cells using the Maxwell 16 Cell LEV DNA Purification Kit and the Maxwell 16 Cell LEV Total RNA Purification Kit (Promega), respectively.
-
bioRxiv - Molecular Biology 2019Quote: ... collected by scraping and lysed in the buffer provided by the Nucleospin RNA isolation kit (Mackerey-Nagel) or the Reliaprep miniprep kit (Promega). RNA was isolated according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded (FFPE) tissue slides using Maxwell® RSC Blood DNA Kit and Maxwell® RSC RNA FFPE Kit (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2022Quote: ... purified with a NucleoSpin® Gel & PCR Clean-up kit (Machery-Nagel) and radiolabeled dCTP-P32 were incorporated with a Prime-a-gene Labeling System kit (U1100, Promega). Oligonucletotide probes were ordered from GenoScreen and radiolabeled dATP-P32 were incorporated with a T4 Polynucleotide Kinase kit (T4 PNK EK0031 ...
-
bioRxiv - Microbiology 2023Quote: ... gallolyticus genomic DNA was extracted using either Wizard Genomic DNA Purification Kit or Wizard SV Genomic DNA Purification Kit (Promega). The extraction was performed according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from FACS purified iPSC-neurons and frozen mouse brain tissue using the ReliaPrep RNA cell kit and ReliaPrep RNA tissue extraction kit (Promega) respectively.
-
bioRxiv - Microbiology 2024Quote: ... difficile was mixed with 50 µL kit reagents (100-fold diluted LgBiT protein, 50-fold diluted substrate in kit buffer, Promega). Subsequently ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR (qPCR) was performed with the primers listed in Table S1 and a GoTaq qPCR Master Mix (Promega, A6002) in a Mastercycler realplex2 thermocycler (Eppendorf) ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μl of DNA was taken as template in a 25 μl PCR reaction using the Go Taq DNA polymerase (Promega) according to the provider’s recommendation ...
-
bioRxiv - Developmental Biology 2021Quote: ... fragment of Snai2 coding sequence (from nucleotides 165 to 971) was PCR-amplified from quail cDNA and cloned in pGEM-T Easy vector (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... Mtfp1 and Gnpat 3’UTRs and Tnksbp1 and Gnpat CDS were amplified by PCR from MIN6 cDNA and subcloned into pmirGLO (Promega), downstream the Firefly ORF ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the desired bands were recovered from the gel using Wizard® SV Gel and PCR Clean-Up System (Promega). Finally ...
-
bioRxiv - Developmental Biology 2021Quote: ... the proximal promoter region (−299/−1) of MyoG was isolated by PCR and inserted into the pGL3-basic vector (Promega). The DNA fragments of PME1 and PME2 in the MyoG promoter region were also amplified and inserted into the pGL3-γ-actin-TATA vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... and random hexamers were used for reverse transcription and PCR amplification was carried out using 25 cycles and GoTaq polymerase (Promega) with linker specific primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... ATFS-11-100(R/R)::GFP and Su91-69::GFP) were synthesized in reticulocyte lysate in the presence of [35S]methionine (T7 Quick for PCR DNA, Promega). Import into isolated mitochondria was performed in import buffer (3 % (w/v ...
-
bioRxiv - Molecular Biology 2021Quote: Viral RNA was extracted from 0.2 mL of cobas PCR Media using Maxwell® 16 instrument (Promega, Madison, WI, USA) for final elution in 30μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... the genomic DNA from all KO cell lines was extracted and the region flanking the Cas9 target site from each ΔPUS cell line PCR amplified and cloned into the EcoRI and HindIII sites of pGEM-3zf vector (Promega). The primers used to amplify the region flanking the Cas9 target sites were the following ...
-
bioRxiv - Molecular Biology 2021Quote: A conventional PCR targeting the hsp65 gene was conducted using the GoTaq® Green Master Mix (Promega, Madison, Wisconsin, USA) in a final reaction volume of 13μl comprising 6.25μl of 2X GoTaq Hot Start Green Master Mix ...
-
bioRxiv - Cell Biology 2020Quote: ... Generated WIP1 and WIP1-ΔκB promoter PCR products were cloned into pGL3-basic luciferase reporter vector (Promega, Madison, WI, USA) using XhoI and BglII restriction enzyme sites and designated as pGL3-WIP1 and pGL3-WIP1-ΔκB ...
-
bioRxiv - Microbiology 2019Quote: For all qRT-PCR reactions 1µg of total RNA was treated with DNase using RQ1 RNase-free DNase (Promega, USA) and transcribed into cDNA (RevertAid First Strand cDNA Synthesis Kit ...
-
bioRxiv - Developmental Biology 2019Quote: A 604bp in situ probe for desmogon was generated from total cDNA of stage 33 medaka embryos by PCR using the following primers fwd: TTCTGCGAGATCAGGCTCAC rev: AAGGCCCCTCCTCTGTAACT and subsequently A-tailed and cloned into a PGEMTeasy vector (Promega). Sense and anti-sense probes were generated using Sp6 and T7 polymerases (Invitrogen ...