Labshake search
Citations for Promega :
2251 - 2300 of 5340 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: The Arg5,6-coding region or a fragment of it was amplified by PCR and cloned into pGEM4 (Promega, Madison, WI) using the EcoRI and BamHI restriction sites ...
-
bioRxiv - Synthetic Biology 2021Quote: ... were generated by in vitro transcription from DNA templates generated by PCR amplification or by fill-in with primer T7X (Supplementary Table 1) using GoTaq (Promega). DNA was purified using QiaQuick (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR products were resolved on a 24% TBE gel and visualized using ethidium bromide or cloned into pGEM-T (Promega) and Sanger sequenced ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl of the cDNA reaction mixture was used as a template in a 50 µl PCR amplification reaction mixture with corresponding forward and reverse primers (Table S2) and GoTaq DNA polymerase (Promega), as described by the supplier ...
-
bioRxiv - Neuroscience 2019Quote: ... The coding region of Caspase9 was PCR-amplified using pX330 as a template and inserted into the pSP64 Poly(A) vector (Promega). Vector were digested and linearized with EcoRI ...
-
bioRxiv - Neuroscience 2019Quote: ... The coding region of Caspase9 was PCR amplified using pX330 as a template and inserted into the pSP64 Poly(A) vector (Promega). Vectors were digested and linearized with EcoRI ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 µl of each reaction was used as template in subsequent PCR amplification reactions in a final volume of 50 µl with the GoTaq Green Mastermix (Promega) in the presence of 0.2 M of each oligo under following conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR product were subsequently disgested by SphI and EcoRI prior cloning into a pGEM®-T Easy Vector (Promega #A1360). Then ...
-
bioRxiv - Neuroscience 2019Quote: ... was amplified via high-fidelity PCR and inserted in-frame along with a firefly luciferase coding sequence (amplified from psiCHECK-2, Promega) with a P2A sequence (Holst et al ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR was performed in a 25 µl reaction volume with 12.5 µl of GoTaq ® Green Master Mix (Promega, USA), 1 µl of 100 ng/µl gDNA ...
-
bioRxiv - Neuroscience 2019Quote: ... The quality of the cDNA was tested using GPDH primers (see below for sequence) and GoTaq endpoint polymerase chain reaction (PCR) protocol (Promega). Quantitative PCR was performed using a SYBR Green protocol (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... gDNA was purified using Purelink spin columns and PCR amplified with specific primers (Supplementary Table S3) using GoTaq Hot Start Polymerase (Promega). PCR conditions were 95°C for 3 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... Amplicons were purified using Qiagen PCR Cleanup (Cat no. 28104) and pooled with pTK nanotag reporter vector with T4 DNA ligase (Promega) and BsmBI (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... Approximately 100bp of the surrounding sequence was amplified by PCR from LX2 cells and cloned into the XhoI site of the pGL3+promoter vector (Promega) with corresponding empty vector as control ...
-
bioRxiv - Cell Biology 2020Quote: ... −2784 bp from the start codon to +688 bp from the stop codon) was amplified from Arabidopsis genomic DNA by PCR and integrated into pGEM-T Easy vector (Promega). First ...
-
bioRxiv - Plant Biology 2021Quote: ... For SlTPD1 a 284 bp DNA fragment from the 5’ coding region was amplified by PCR using cDNA from flowers and cloned into the pGEM-T Easy vector (Promega). For TomA5B and SlSDS genes ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’ GA CTC GAG GTT GCA CCT AGT GGA T 3’ The PCR product was first cloned into pGEM-T easy vector (Promega), verified by sequencing and subsequently cloned into pGEX5.1 vector using the EcoRI and XhoI sites ...
-
bioRxiv - Evolutionary Biology 2020Quote: To generate the pGl3-STK38-P luciferase reporter,1.2 kb of DNA upstream the STK38 TTS promoter region with ZNF611 binding motif was amplified by polymerase chain reaction (PCR) and cloned into the Firefly luciferase reporter plasmid pGL3-Basic (Promega) using KPN1 and XHO1 restriction sites.0.7 kb of DNA upstream the STK38 TTS promoter region without ZNF611 binding motif was cloned into pGL3-Basic using same restriction sites to generate the pGl3-STK38-ΔP luciferase reporter ...
-
bioRxiv - Genetics 2021Quote: ... Bands purification were made with Wizard® SV Gel and PCR Clean-Up System (Promega, 2800 Woods Hollow Road·Madison, USA). Next ...
-
bioRxiv - Genetics 2021Quote: ... 3ul of gel extracted PCR product was used for TA cloning with the pGEM-T Easy Vector System (Promega, A1360) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR products and restriction enzyme digestions were purified by agarose gel electrophoresis followed by processing with the Wizard SV Gel and PCR clean up system (Promega). Restriction enzymes were purchased from Fermentas ...
-
bioRxiv - Microbiology 2020Quote: ... The genomic region flanking the Cas9 target site from each ΔNAT10 cell line was PCR amplified and cloned into the XbaI/SalI sites of pGEM-3zf+ vector (Promega). 10+ bacterial cell clones of pGEM-genomic-region-plasmid from each CRISPR-knockdown cell clone were isolated for Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... the coding sequence of REST/NRSF ZF1-8 were amplified by PCR using cDNA as templates and cloned into the pTNT vector (Promega) between the EcoRI and XbaI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’UTR PCR products were directionally cloned downstream of the Renilla luciferase open reading frame (ORF) of the psiCHECK2 vector (Promega) that also contains a constitutively expressed firefly luciferase gene ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 μL of cDNA was used for 25 μL PCR reactions using the GoTaq Hot Start Master Mix (Promega). Cycling parameters consisted of an initial denaturation of 95°C for 2 min. ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genome editing efficiency was checked by PCR on genomic DNA from the transfected population with the GoTaq G2 polymerase (Promega) using primers surrounding the 210 bp deleted region ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pups were screened for the deletion by classical genotyping PCR with the GoTaq R2 Hot Start Green Master Mix (Promega) with fw (5’-CCTCGGAAGCTGCCTAAGAT-3’) ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Microbiology 2022Quote: ... Further taxonomic affiliation was carried out on these clones after PCR amplification of the rDNA genes using the same primers as above and Pfu DNA polymerase (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR fragments were purified over gel and the DNA was recovered using the Wizard SV Gel and PCR Clean-Up System (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were purified on a 1% agarose gel and ligated into a pGEM-T Easy Vector Systems (Promega) plasmid followed by transformation in E ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR products were visualized using agarose gel electrophoresis and subsequently cloned into a pGEM-T easy cloning vector (Promega, Australia). Blue/white colonies were screened using standard techniques and a test digestion with endonuclease restriction enzyme EcoR1 was carried out to confirm insertion ...
-
bioRxiv - Neuroscience 2022Quote: ... Templates for RNA FISH probes were amplified by PCR from genomic DNA (Table S3) and cloned into pGEM-T Easy (Promega) or pCRII-TOPO ...
-
bioRxiv - Molecular Biology 2022Quote: ... Next two overlapping fragments containing one of the homologies and a part of the antibiotic marker were generated by PCR using Taq polymerase (Promega), which overlap for a length of 594 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by extracting DNA from tail clippings with Extracta DNA Prep for PCR—Tissue (Quanta Biosciences) and specified products amplified using either GoTaq Green Mastermix (Promega) or 2x KAPA buffer ...
-
bioRxiv - Microbiology 2023Quote: ... gondii glyceraldehyde 3-phosphate dehydrogenase 2 (GAPDH2, ML5049/ML5680) or TgAPT1 (ML4097/ML4098) were used for subsequent PCR amplification with GoTaq polymerase (Promega) for twenty-five cycles as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... were used in qRT-PCR reactions to determine the relative mRNA levels of Tc_wap genes using GoTaq® qPCR Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The kan gene was then inserted between the upstream and downstream 05515-05525 flanking PCR fragments and simultaneously inserted into the pGEM-7Zf vector (Promega) in the BamHI and XhoI sites using the In-Fusion kit according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the coding sequence of HIV-1 Nef (SF2 variant) was amplified by PCR and inserted into the plasmid pNLF-1-C (Promega) for expression of NanoLuc at the Nef C-terminus ...
-
bioRxiv - Microbiology 2023Quote: ... generated by cloning the entire coding sequence of mouse APOBEC1 (mAPOBEC1) amplified from mouse cDNA by PCR into pGEM-T-easy (Promega), and cloning it into the EcoRI and SalI sites of pEGFP-C2 (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: The HLB1 coding sequence corresponding to the N-terminal 200 amino acids was amplified by PCR using the following primers and was cloned into pGEM-T-easy vector (Promega). The NdeI and XhoI fragment of HLB11-200 was cloned into pET28a vector (Novagen ...
-
bioRxiv - Microbiology 2023Quote: ... Shigella conjugants that grew at 30°C and were Cb60 resistant were screened by PCR for the presence of lpxE and the large virulence plasmid using GoTaq (Promega) and primer sets lpxE-F/lpxE-R (lpxE ...
-
bioRxiv - Neuroscience 2023Quote: ... The presence of a 108 bp deletion in Stx6 was determined using two PCR reactions with the following primer combinations with GoTaq G2 Hot Start Polymerase (Promega): PCR 1 forward 5’-CGATCTGTGAGACTCATCGGG and reverse 5’-GGGAGTCCTAACACCACCTTC ...
-
bioRxiv - Plant Biology 2023Quote: ... MSIL4-GFP/MSIL4G-tagged version used for complementation and RIP corresponds to the fusion of a genomic PCR product containing MSIL4 promoter (primers TL3527(HindIII)-TL3528(SalI)) fused with a second PCR cDNA fragment (primers TL3529(SalI)-TL3530(BamHI)) cloned initially in pGEM T Easy (Promega). After sequencing the fusion DNA has been cloned in the binary vector CTL579 containing GFP cDNA sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR-amplified libraries were purified and size selected for fragments of 200-250bp using the Pronex paramegnetic beads (Promega # NG2001) according to manufacturer instructions ...