Labshake search
Citations for Promega :
2201 - 2250 of 5340 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: A 604bp in situ probe for desmogon was generated from total cDNA of stage 33 medaka embryos by PCR using the following primers fwd: TTCTGCGAGATCAGGCTCAC rev: AAGGCCCCTCCTCTGTAACT and subsequently A-tailed and cloned into a PGEMTeasy vector (Promega). Sense and anti-sense probes were generated using Sp6 and T7 polymerases (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: Expected products of SDDV ATPase fragment amplification (135 bp) obtained from the above PCR assays were cloned into pGEM-T easy vector (Promega) and transformed into E ...
-
bioRxiv - Microbiology 2019Quote: ... coli HT115 gadA gene was amplified by PCR using primers NgadAFw and NgadARw with Taq polymerase and cloned in the pGemT Easy plasmid (Promega) according to manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2019Quote: ... 40 μL of supernatant was then transferred from each sample to PCR strip tubes and mixed with 10 μL Renilla luciferase lysis buffer (Promega). Prepared samples were then stored at −20°C until luciferase assays were run ...
-
bioRxiv - Biophysics 2019Quote: ... the same DNA was combined with a PCR fragment amplified from cZP1full/pGEM57 to generate a 6His-tagged full-length cZP1 ORF in pSI (Promega). The pHLsec3 construct expressing C-terminally 6His-tagged mZP1-N1M1-A141 was generated by PCR ...
-
bioRxiv - Microbiology 2019Quote: ... The linear amplification product was purified using the Promega Wizard SV Gel and PCR Clean-up System (Promega Corporation, A9282), and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S) ...
-
bioRxiv - Cell Biology 2019Quote: A cDNA fragment corresponding to nt995-1537 of mouse trip6 cDNA (GenBank accession number NM_011639.3) was generated by PCR and subcloned into the pGEM-T Easy Vector (Promega, Madison, WI). Radiolabeled riboprobes were generated by using [35S]UTP (Hartmann Analytik ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The allelic frequencies of the long and short alleles in the northern Queensland population were found by taking 14 samples of 56 to 92 flies and individually PCR genotyping all flies in the sample using GoTaq (Promega). Primer sequences ...
-
bioRxiv - Neuroscience 2020Quote: ... Mice were genotyped by extracting DNA from tail clippings with Extracta DNA Prep for PCR – Tissue (Quanta Biosciences) and specified products amplified using either GoTaq Green Mastermix (Promega) or 2x KAPA buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... Genomic regions flanking the CRISPR target sites were PCR amplified with designed primers (Supplemental Table 3) using GoTaq DNA polymerase (Promega) and sent for Sanger sequencing to determine the insertion and deletion errors generated by CRISPR-Cas9 system in exon 2 of PARKIN ...
-
bioRxiv - Biochemistry 2020Quote: ... or ∼30 ng (Proevolidine and Proxanthoxycyclin E gDNA) of the A-tailed PCR product were ligated into 50 ng of the pGEM-T Easy vector (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was probed with a 400 bp 32P-labelled PCR product of the TbCls 3’UTR generated with the prime-a-gene labelling system (Promega). Primers used for PCR were ...
-
bioRxiv - Bioengineering 2020Quote: ... The second round of PCR was run with 10μL GoTaq Green Master Mix (Promega Biosciences LLC, San Luis Obispo, CA), 4.2μL of water ...
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA was extracted using HotSHOT (hot sodium hydroxide and tris) and PCR was performed using GoTaq green master mix (Promega) (Truett et al ...
-
bioRxiv - Cell Biology 2021Quote: ... ShhN dsDNA coding for residues 1-198 of murine Shh was obtained by PCR using Pfu polymerase (Promega cat # M7741) and the following primers ...
-
bioRxiv - Neuroscience 2020Quote: A DNA fragment bracketing the proximal promoter and transcription start site of the Iqsec3 gene (–280 to +36) was PCR-amplified from mouse genomic DNA and subcloned into the pGL3-Basic vector (Promega). Full-length mouse Npas4 cDNA was subcloned in pcDNA3 (Gibco-Invitrogen) ...
-
bioRxiv - Plant Biology 2020Quote: ... Amplified products were sent to the Australian Genome Research Facility for sequencing to confirm identity following the use of the Wizard SV Gel and PCR Clean-Up System (Promega).
-
bioRxiv - Plant Biology 2020Quote: ... 10 μL DNase I digested small RNA extracted from NF- and NF+ were reverse transcribed with random primers and the cDNA was used for PCR by using GoTaq flexi DNA polymerase (Promega). 100 ng total RNA extracted from Arabidopsis protoplast cells were reverse transcribed and used as positive control to indicate the proper size of amplified products ...
-
bioRxiv - Plant Biology 2020Quote: ... or a 1007-bp fragment of CaUNI (182–1188 from ATG) amplified by PCR and cloned into the pGEM-T Easy vector (Promega). Transcription of probes was carried using SP6 and T7 polymerases ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR mixture was at a volume of 10 μL containing 5 μL SYBR Premix Ex Taq (Promega, Madison, USA), 0.5 μM each of the primers ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The PCR reaction was carried out in a 50 μl reaction volume containing 1.25 U GoTaq Flexi DNA Polymerase (Promega, USA), 10 μl of 5X Flexi Reaction Buffer (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Two allelic replacement vectors—pFtsH1G489G carrying two synonymous “shield” mutations and pFtsH1G489C carrying a further G to T mutation at base 1465 (Figure 1A)—were created by cloning a PCR amplified segment of Pfftsh1 into pGEM-T Easy (Promega). Quickchange XL (Clontech ...
-
bioRxiv - Bioengineering 2020Quote: ... The second round of PCR was run with 10μL GoTAQ Green Master Mix (Promega Biosciences LLC, San Luis Obispo, CA), 4.2μL of water ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Cell Biology 2021Quote: ... for 1 hour at 37°C and DNA was extracted using the Wizard SV gel and PCR cleanup system (Promega). Input and immunoprecipitated DNA was subjected to quantitative PCR using the oligonucleotides shown in Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cohesive ends were generated by restriction digestion of this PCR product using Eco R1 and Not1 and ligated using T4 DNA ligase (Promega) with Eco R1 ...
-
bioRxiv - Genetics 2022Quote: ... Vectors coding for repair template DNA of roughly 2 kb were generated from Drosophila Schneider 2 cell genomic DNA by PCR using GoTaq G2 Polymerase (Promega) and primer pairs appropriate for the desired region (Supplementary Table S1) ...
-
bioRxiv - Microbiology 2022Quote: ... Clonal line selection was then performed with newly acquired mutant strains before molecular verification by diagnostic PCR using GoTaq DNA polymerase (Promega) and multiple sets of primers (Tables S9 and S10) ...
-
bioRxiv - Microbiology 2022Quote: The upstream regions of genes of interest were amplified by PCR with specific primers (Table S1) and cloned into the pGEM-T easy plasmid (Promega). After digestion with proper restriction enzymes (Table S1) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The VEGFA probe was a 600bp fragment amplified using PCR from HH stage 15 embryo cDNA using primers CCATGAACTTTCTGCTCACTTGG and CTGCTCACCGTC-TCGGTTTTTC and cloned into pGEM-T Easy (Promega). The VEGFR2 probe was a generous gift from C ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana cDNA using gene-specific primers listed in Supporting Information Table S1 as a NcoI-KpnI fragment by High Fidelity PCR (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... the 2206 bp immediately upstream of the SCL30a start codon were PCR-amplified (S7 Table) from genomic DNA and subcloned into the pGEM vector (Promega), where the eGFP-GUS segment isolated from the pKGWFS7 vector [69] using the SacII/NcoI restriction sites was fused at the 3’ end of the SCL30a promoter sequence ...
-
bioRxiv - Molecular Biology 2020Quote: ... the ∼600 bp homology sequence to the target site was amplified by overlapping PCR and inserted into a Sal I and Not I digested pGL3-Basic plasmid (Promega). Cas9 and donor plasmids were co-transfected using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Luciferase constructs were obtained by PCR amplifying the 3’UTR regions from cDNA extracts and cloning them into a modified phRL-CMV vector (Promega), as previously described (Favereaux et al. ...
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously26 ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 ng total DNA was added to a 20 μl PCR containing 10 μl GoTaq® Master Mixes (Promega, USA) and 0.1 μM of each primer pair ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously ...
-
bioRxiv - Microbiology 2022Quote: All isolates were heat-extracted at 95°C for 20 minutes for polymerase chain reaction (PCR) using GoTaq (Promega M7132) and 8F and 1492R primers to amplify the whole 16S rRNA gene (4) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Physiology 2019Quote: Relative expression levels of Fgf23 were determined by qRT-PCR using 2 μl synthesized cDNA and the GoTaq qPCR Master Mix (Promega) on a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells with successful incorporation in the genomic locus of EGFP or TagRFP were screened by PCR using GoTaq Polymerase (Promega).
-
bioRxiv - Genetics 2019Quote: ... genomic sequence downstream of the Nse4 gene was PCR amplified (JP414 and JP415) and inserted to the pGEM-Easy vector (Promega); 3 ...
-
bioRxiv - Genetics 2020Quote: PCR used to detect the viral cDNA was performed using the GoTaq® Green Master Mix (Promega, Madison, WI, USA) under the following conditions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sense (5’-AGGAAACTGAAAAACAGAGTAGCAGC-3’) and antisense (5’-TCCTTCTGGGTAGACCTCTGG-3’) primers were used in a standard GoTaq Green PCR reaction (Promega) to amplify a region spanning the 26-nucleotide intron that includes a single PstI restriction site ...
-
bioRxiv - Bioengineering 2019Quote: ... a specific WDV nucleotide sequence (140 bp, primers UniWDVfw+UniWDVrv) amplified by PCR was inserted into the vector pGem-T Easy (Promega) and cloned into E ...
-
bioRxiv - Plant Biology 2019Quote: ... and the presence of T-DNA alleles or wild-type alleles was tested via PCR using gene-specific and the LBb1.3 primers (Table S3) using the GoTaq® Hot Start Polymerase (Promega). The program was ...
-
bioRxiv - Genetics 2020Quote: ... and the mitogenome was extracted from the excised band by using the Wizard SV Gel and PCR Clean-up System (Promega).
-
bioRxiv - Molecular Biology 2020Quote: Purified PCR products which amplified specific on-target or off-target sites were inserted into a T-easy vector (Promega) and transformed into DH5-α bacterial cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... were PCR amplified and cloned into either pGL3-Promoter firefly luciferase reporter vector or pGL3-Basic luciferase reporter vector (Promega). Constructs were verified by Sanger sequencing ...
-
bioRxiv - Genetics 2020Quote: ... An 812 bp region (3L: 15825979..15826790) spanning the candidate mutated region in DCP2 was PCR amplified and ligated in pGEM-T vector (Promega) to generate the pGEM-T-812 clone ...