Labshake search
Citations for Promega :
1751 - 1800 of 2354 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... PCR was performed in a 20 µL reaction containing 1X Colorless GoTaq Flexi Buffer (Promega), 1.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was purified using Wizard SV Gel and PCR Clean-Up System (Promega). The linearized Donor was combined with the HCMV GW BAC in a Gateway reaction with LR Clonase II Plus enzyme (Thermo-Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... and purified using the Wizard SV Gel system and the PCR Clean-Up System (Promega).
-
bioRxiv - Microbiology 2023Quote: ... PCR was conducted with the following reaction composition: 0.1 U/ µL Gotaq (Promega, Madison, WI), 1X Gotaq buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products of nifH and rnpB were each cloned into the pGEM-T plasmid (Promega). cDNA concentrations in nanograms per microliter were measured by Qubit 2.0 fluorometer (invitogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in reactions requiring downstream usage of PCR products or the GoTaq green master mix (Promega), where downstream application was not required ...
-
bioRxiv - Microbiology 2024Quote: ... Presence and orientation of the linker was confirmed by colony PCR using GoTaq polymerase (Promega) with primers oMJF042 and oMJF055 ...
-
bioRxiv - Physiology 2024Quote: ... Real-time PCR reaction was performed with the GOTaq® qPCR Master Mix (A6001, Promega) and CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2024Quote: ... The quantitative real-time PCR was performed using the GoTaq qPCR Master Mix kit (Promega) following the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... Purified products were used as template for 50 µl PCR reactions containing 1x GoTaq (Promega), 0.3 µM each of oligonucleotides JelAP1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and ABCB-CoChR-mCherry gene fragments were PCR amplified from pNL-CMV-NLuc (Promega #N1091), pcDNA3.0-Magneto2.0-p2A-mCherry ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR products from the CAPS analysis were cloned into the pGEM T-easy vector (Promega) and purified using ExoSAP-IT reagent (Affymetrix) ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons were gel-purified using Wizard® SV Gel and PCR Clean-Up System (Promega) and quantified with a Qubit 4 Fluorometer (Thermofisher scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... the DNA was purified using the Wizard SV Gel and PCR Clean Up Kit (Promega). Immunoprecipitated DNA was analyzed by qPCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Plant Biology 2019Quote: ... The PCR amplification product was cloned into a pGEM®-T-Easy vector (Promega, Madison, Wisconsin) and named pHaHB4.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... which served as the template of quantitative PCR in the GoTaq® qPCR Master Mix (Promega). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were cloned into the pGEM-T Easy vector according to the manufacturer’s instructions (Promega) and sequenced using predesigned primers against the T7 promoter (MWG Eurofins).
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCRs were performed with the GoTaq G2 Hot Start Green Master Mix (Promega, Madison, WI, USA) in an Applied Biosystems 2720 Thermal Cycler (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... The PCR reactions were performed using GoTaq®G2 Green Master Mix (Promega, WI, USA; #M7823) or Taq 2x Master Mix Kit (New England Biolabs® Inc. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral RNA of SARS-COV-2 was detected by TaqMan®-based Real-Time PCR (Promega) using a CDC protocol with two sets of primer/probe which amplifies virus nucleocapsid (N ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR products were amplified from HEK293T cDNA and inserted into the pGL3-Basic vector (Promega) using the overlap extension cloning method [4] ...
-
bioRxiv - Genomics 2020Quote: ... an amplicon containing a SNP was amplified by PCR from cDNA using GoTaq Flexi G2 (Promega) with 2.5 mM MgCl2 or Hot Star Taq (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length human RNU6 sequence (110 nucleotides) was amplified by PCR and cloned into psiCHECK2 (Promega), downstream of Renilla luciferase ...
-
bioRxiv - Microbiology 2019Quote: ... Five brands of H2O PCR grade were tested: Nuclease-free water (Cat. No. P119C, Promega, USA); UltraPure™ DNase/RNase-Free distilled water (Cat ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The band was excised and the Wizard® SV Gel and PCR Clean-up System (Promega) to extract and purify the DNA from the gel ...
-
bioRxiv - Genomics 2019Quote: The PCR products were excised from agarose gels and ligated into pGEM-T vector plasmids (Promega) with T4 DNA ligase (Promega) ...
-
bioRxiv - Genomics 2019Quote: ... PCR was performed according to the manufacturer’s recommendations (GoTaq DNA polymerase protocol, Promega, Madison, WI, USA). All PCR products were purified using the EPPIC Fast kit (A&A Biotechnology ...
-
bioRxiv - Molecular Biology 2019Quote: Amplified fragments were purified using a Wizard SV Gel and PCR Clean-Up System (Promega #A9281), diluted at a concentration of 1 µg/20 µl ...
-
bioRxiv - Genomics 2020Quote: The mid-transcript PCR product was ligated to pGEM®-T Easy vector (Promega Corporation, USA), following the manufacturer’s instructions and transformed into E ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA was PCR amplified using 2× GoTaq Colorless Master Mix (Promega, Madison, WI, USA), and PCR product was extracted as above to eliminate primer-dimers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and the amplified PCR products were ligated into the pGEM-T easy vector (Promega Madison, WI) for DNA sequence verification ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR reaction was conducted in a 50 μl contained Go Taq Colorless Master Mix (Promega), 20 μM Tn5-DPO primer ...
-
bioRxiv - Cell Biology 2021Quote: The upstream region of myogenin (−1650/+51) was PCR-amplified and clonedinto the pGL4.20 vector (Promega). The hnRNPK-expressing plasmid was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2020Quote: ... Point mutations were introduced by PCR mutagenesis using the Pfu DNA polymerase (Promega, Alexandria, VIC, Australia). Cells were transfected using Lipofectamine® 3000 (Thermofisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was performed by using GoTaq® qPCR Master Mix (Promega Corporation, Madison, Wisconsin, EUA) accordingly to the manufacturer instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR verifying experiments were performed with Go Taq Green Master Mix (Promega, Charbonnières les Bains, France), and PCRs requiring proofreading were performed with the Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Obtained DNA was purified using the Wizard SV Gel and PCR Clean up system (Promega, US) in a final volume of 50 μL ...
-
bioRxiv - Cancer Biology 2020Quote: The region of interest (750-850 bp) was PCR amplified from pooled male human DNA (Promega) and cloned into a STARRseq luciferase validation vector_ORI_empty plasmid (Addgene plasmid #99298 ...
-
bioRxiv - Cell Biology 2021Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-up system (Promega). A guide sequence (TATTCGAGGCCATCGTGTACCGG ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... qRT-PCR was performed using SYBRGreen-based technology GoTaq® qPCR master-mix (Promega, Cat# A600A). Specific SNX14 primers ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 μL of passive reference (ROX) dye (GoTaq® Q-pcr Master Mix, cat# A6001, Promega), and 1.1 μL of nuclease-free H20 ...
-
bioRxiv - Cell Biology 2022Quote: ... The HaloTag-SmBiT fragment was PCR amplified from the commercially available plasmid (Promega, Cat no: N202A) and also subcloned into pcDNA3.1 ...
-
bioRxiv - Immunology 2021Quote: A semi-nested PCR was performed using a HotStart GoTaq Polymerase System (M500,1 Promega, Madison, WI). In addition to the forward and reverse primers used to amplify the paired TCRα:β templates ...
-
bioRxiv - Microbiology 2019Quote: ... BRYT GreenTM dye-based quantitative PCR (qPCR) was performed with the GoTaqTM qPCR Master Mix (Promega) and intron-spanning primer pairs (see Table S3 for a list of all primers) ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Cell Biology 2019Quote: ... The amplified PCR products were purified and cloned into pGEM-T Easy (Promega, Madison, WI, USA) and sequenced (1st Base ...
-
bioRxiv - Plant Biology 2021Quote: ... The qRT-PCR was performed in a reaction containing GoTaq® qPCR Master Mix (Promega, USA), cDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The Mobius Assemblies were verified first by colony PCR using GoTaq® Green Master Mix (Promega) and then with double restriction digestion with EcoRI-HF (NEB ...
-
bioRxiv - Systems Biology 2021Quote: ... Both 1° and 2° assays were performed with 2x PCR master mix (Promega Corporation, Wisconsin, USA). The final PCR product from the 2° nested PCR was checked by electrophoresis in a 1.5% agarose gel ...