Labshake search
Citations for Promega :
1551 - 1600 of 2354 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Extracted DNA was used to template PCR reactions with GoTaq polymerase (Promega #M3001) to amplify ITS (primers emITS-1:TGGTAGAGAATGATGGCTGTTG and emITS-4:GCCTCTATGCCTAATTGCCTTT ...
-
bioRxiv - Microbiology 2023Quote: ... Real time quantitative PCR was performed using GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR product was first cloned in the pGEM-T Easy vector (Promega) and sequenced ...
-
bioRxiv - Molecular Biology 2023Quote: QRT-PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat# A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genetics 2024Quote: ... Purified PCR products (deletion-bearing, second-step amplicon) and the pGL4.23 vector (Promega) were double digested with NheI-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed with a Gotaq G2 Hot Start Polymerase system (#M7405, Promega). Pyrosequencing was conducted on a Pyromark Q96 Sequencer using matching reagents (#97204 ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR reactions were performed with GoTaq G2 Flexi DNA Polymerase (Promega, Cat. #M7801) or Herculase II Fusion DNA Polymerase (Agilent ...
-
Regulation of Diseases-Associated Microglia in the Optic Nerve by Lipoxin B4 and Ocular HypertensionbioRxiv - Molecular Biology 2024Quote: ... and Cd68 were quantified by using GoTaq PCR master mix (Promega, Madison, WI) in OneStep Plus qPCR (Applied Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... The secondary PCR product was cloned in pGEMT-Easy vector (Promega Madison, USA), and Sequencing was performed using the nos promoter’s AP2 and 5’ junction (Eurofins Genomics India Pvt ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were sub-cloned into the pGEM-T Easy vector (Promega, A1360) and sequenced ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products were verified by sequencing cloned into the pGL3-Control vector (Promega) by Gibson Assembly ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified using Wizard® SV Gel and PCR Clean-Up System (Promega). Next ...
-
bioRxiv - Biochemistry 2024Quote: ... the PCR products of the Strep-Flag-tag and NLuc (Promega, cat # N1091) were inserted into the pHLmMBP-8 vector (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... Untagged CDK2 expression plasmid was cloned by PCR with CDK2-NLuc plasmid (Promega) as the template ...
-
bioRxiv - Cell Biology 2024Quote: ... The genome-edited monoclonal cell populations were identified by PCR (GoTaq Polymerase, Promega) and then verified by western blot analysis and imaging.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR was run for 30 cycles using GoTaq G2 Green master mix (Promega) and specific primers ...
-
bioRxiv - Neuroscience 2023Quote: The PCR fragment were ligated into a pGEM-T Easy Vector System (Promega), transformed into chemically competent cells and sequenced ...
-
bioRxiv - Cell Biology 2021Quote: ... 30 min at 60°C) an alkylation (IAA 0.5M, 30 min RT) microtubule-associated protein enriched fractions were digested using trypsin (Gold, Promega, 1 μg / sample, overnight at 30°C). Peptide clean-up was done using OMIX C18 (Agilent ...
-
bioRxiv - Microbiology 2020Quote: ... Two-rounds of translocation PCR was performed using GoTaq G2 Green Master Mix (Promega). In the first round PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... Probes for in situ hybridization were made by cloning PCR products into pGemTeasy (Promega). 1 µg of the linearized plasmid was transcribed in vitro using NTP labelling mix and T7 or sp6 RNA Polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... Amplicons were purified with Wizard® SV Gel and PCR Clean-Up System (Promega) and sequenced via the Eurofins TubeSeq service ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using the Wizard SV Gel and PCR Clean-up System (Promega, A9281) as per manufacturer directions ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat. M3001) in LightCycler® 480-Roche System according to the supplier’s manual ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were inserted into the pGEM-T Easy Vector System (Promega, A1360) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... PCR was performed with the generated cDNA and premixed 2× Taq polymerase solution (Promega) in an MJ Mini Thermal Cycler (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... A-tailed PCR amplicons were cloned into p-GEM-T Easy Vector System (Promega) per manufacturer instructions and ligation reactions introduced directly into electrocompetent XL1-Blue E ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCRs were done in triplicates using the GoTaq qPCR Master Mix (Promega, A6002) and the LightCycler 480 Instrument (Roche Diagnostics) ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR products were purified and cloned into a pGEM-T Easy vector (Promega, USA) according to the manufacturer’s instruction and the identity of inserts confirmed by sequencing.
-
bioRxiv - Physiology 2020Quote: ... PCR products of correct sizes were extracted and cloned into pGEMT easy vectors (Promega). The inserts (Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and for diagnostic PCR reactions (GoTaq® Green Master Mix (Promega; Art. No.:M7845). PCR was performed according to the respective manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... The concentration of purified PCR products was measured with QuantiFluor™-ST system (Promega). Then the barcode-tagged amplicons from different samples were mixed in equimolar concentration and sent to the Majorbio Bio-Pharm Technology Co. ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were purified and cloned into a pGEM-T Easy vector (Promega, USA) according to the manufacturer’ s instruction and the identity of inserts confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative real-time PCR (qPCR) was carried out using GoTaq qPCR master mix (Promega) on CFX96 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Genomics 2019Quote: ... purified and concentrated using Wizard® SV Gel and PCR Clean-Up System (Promega). Sanger sequencing confirmed correct amplification of PCR fragments ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative real-time PCR (qPCR) assays were performed using GoTaq qPCR Master Mix (Promega) on a ViiA 7 Real-Time PCR System according to manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: Purified PCR fragments were cloned into a pGEM-T Easy Vector (Promega, Madison, Wisconsin), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse ACGTGGCTGCATTAGGAGAG The resulting PCR amplicons (658 bp) were cloned into pGEMT vector (Promega) before Sanger sequencing of individual inserts.
-
bioRxiv - Bioengineering 2020Quote: ... Genotyping PCR assays were performed using GoTaq Green Master Mix (Promega, Madison, WI, USA). The oligonucleotides used in this study (Supplementary Table 8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... adenines were added to the end of the PCR product using Taq polymerase (Promega) before performing a TOPO reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... Resulting products were purified using Wizard SV Gel and PCR Clean-Up columns (Promega) and submitted for Sanger and NGS (Amplicon EZ ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA template was used for PCR reaction with GoTaq Green Master Mix (Promega). The primers for RT-PCR are listed in Supplemental Table S1.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol and directly sequenced using 10F primer to identify individual bacteria isolates at the genus level ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each remaining product was purified using Wizard® PCR Preps DNA Purification System (Promega). PCR products were subsequently cloned into pGEM®-T Easy Vector plasmids in a JM109 High- Efficiency Competent Cells (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... We used the resulting cDNA to perform quantitative PCR with GoTaq master mix (Promega), and analyzed data with the standard ΔΔCt method ...
-
bioRxiv - Microbiology 2021Quote: ... Products were cleaned with the Wizard SV Gel and PCR Clean-Up System (Promega) and cloned with the pGEM-T easy Vector Systems (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... All integron PCRs were performed using GoTaq® Colorless Mastermix (Promega, Madison, Wisconsin, USA), 0.4 μM of each primer and 2 μL DNA (boil preparation method ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR products were verified by sequencing and ligated into the pGL3-Control vector (Promega), downstream of the luciferase reporter gene ...
-
bioRxiv - Cell Biology 2021Quote: ... qRT-PCRs were performed with the SYBR-Green Real Time Master Mix (Promega; A600A) according to manufacturer’s instructions using a BioRad CFX96 machine ...
-
bioRxiv - Cell Biology 2021Quote: ... and the targeted region was amplified by Taq polymerase PCR (cat. num. M7501, Promega). Sequence verification was achieved by TOPO-cloning (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes from PCR products were radiolabeled using the Prime-a-Gene kit (#U1100, Promega) in the presence of [α-32P]-dCTP (Hartmann Analytic ...