Labshake search
Citations for Promega :
1201 - 1250 of 2189 citations for Pops Par Solution Unlabeled 2000 Ng Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Flp-In T-REX HeLa cells were transfected with 1.8 μg of pOGG4 plasmid and 200 ng of pcDNA5/FRT/TO plasmid encoding the relevant transgene cassette using FuGENE HD transfection reagent (Promega). Cells with a stably integrated transgene were selected with 150 μg/mL hygromycin for 4-5 days ...
-
“Identification of microRNAs regulated by E2F transcription factors in human pluripotent stem cells”bioRxiv - Developmental Biology 2024Quote: ... 500 ng of total RNA was used for cDNA synthesis with 15 mM of random hexamers and MMLV reverse transcriptase (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA was extracted from 400 μL of each fraction (spiked with 0.2 ng exogenous control FFLuc mRNA; Promega # L4561) by adding 600 μL TRIzol (Thermo Fisher # 15596018 ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Integrated sgRNAs in each lymphoma sample were amplified from 100 ng of genomic DNA using GoTaq Green Master Mix (Promega) and indexing primers with unique overhangs (12) ...
-
bioRxiv - Cell Biology 2023Quote: ... dilute with 4 volumes of 20 mM Tris-HCl pH8 / 2 mM CaCl2 before overnight digestion at room temperature with 100 ng sequencing grade trypsin (Promega). Samples were centrifuged ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tail DNA from offspring was genotyped for the presence of the BAC transgene by analyzing 100 ng of tail DNA with the GoTaq PCR reaction kit (Promega) according to the manufacturer’s instruction by adding forward primer 5′-GAGGCTCGGGTGCGGCAGCTC −3′ and reverse primer 5′-GTGCAGTGTGAGCACCTGCTGTC-3′ for PCR with an initial denaturation for 3 min at 95 °C ...
-
bioRxiv - Genetics 2024Quote: ... Cells were co-transfected after 24 hours with 50 ng of the CNTNAP5 luciferase reporter constructs along with 10 ng of pRL-TK Renilla luciferase internal control using FuGENE HD transfection reagent (Promega). At 48 hours post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were resuspended in 50 μl 100 mM TEAB and digested with 200 ng trypsin (Promega sequencing grade) overnight at 37°C.
-
bioRxiv - Cell Biology 2023Quote: ... in-gel digestion was performed on the PNS and enriched peroxisomal membranes using 300 ng trypsin (sequencing grade modified trypsin V5111; Promega) after reduction with 10 mmol/L dithiothreitol and alkylation with 55 mmol/L iodoacetamide proteins as described previously (Wolters et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 500 ng of RNA were reverse-transcribed using M-MLV Reverse Transcriptase and Random Hexamer primers (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 49 ng of a TP1-Luciferase (Kurooka et al., 1998; Minoguchi et al., 1997) and 1 ng Renilla-Luciferase (pRL-TK, Promega) using Lipofectamine™ 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... pI.18-3xFlag-myRIG-I or pI.18-3xFlag-roRIG-I (25 ng/well each) together with transfection control pLR-SV40-Renilla (Promega) (50 ng/well ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was extracted from 400 μL of each fraction (spiked with 0.2 ng exogenous control FFLuc mRNA; Promega # L4561) by adding 600 μL TRIzol (Thermo Fisher # 15596018 ...
-
bioRxiv - Biochemistry 2023Quote: ... The gel pieces were dehydrated using 100% ACN before 25 µl of 12 ng/µl sequence grade modified trypsin porcine (Promega) in 25 mM ABC was added ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 ng of either XeARPP19 or ClyARPP19 were incubated with 200 μM ATP and 25 units of recombinant bovine PKA (Promega) in PKA Buffer for 3 hours at 37°C under 1200 RPM stirring ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 500 ng of each of the packaging plasmids were transfected into 293T cells using FuGENE 6 transfection reagent (Promega). The viral media was exchanged after 24 h ...
-
bioRxiv - Biochemistry 2023Quote: ... then alkylated (100 mM iodoacetamide in 100 mM ammonium bicarbonate at room temperature for 45 minutes) prior to in-gel trypsin digestion (30 μL of 6 ng/μL recombinant sequencing-grade trypsin (Promega) in 100 mM ammonium bicarbonate per cubed band ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library preparation involved using 100 ng of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA from Promega. Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 50 ng of the plasmid encoding for the GFP-stop-Luc reporter were mixed with 1.1 μ FuGENE HD reagent (Promega), incubated for 10 min ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20-μl final volume reaction using random primers (Cat ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 20 ng of trichome DNA was amplified by combining 0.25 μM primer and 1X GoTaq Green Master Mix (Promega, USA) in a 50μl reaction volume ...
-
bioRxiv - Cell Biology 2022Quote: ... on-bead digestion was performed by addition of 100 μL trypsinization buffer (50 mM ammonium bicarbonate, Sigma and 300 ng trypsin per column, Trypsin-gold V5280 Promega) for 1 h at 23°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... The gel slices were then reduced and alkylated followed by destaining and in-gel digestion using 125 ng Trypsin/LysC (V5072, Promega) as previously described (Shevchenko ...
-
bioRxiv - Genomics 2022Quote: ... Each transfection reaction consists of 20 μg of testing vector and 500 ng of Renilla-expressing phRL-TK (Promega #6251) mixed with 3.5E6 cells in buffer T using 100 μL Neon Tips (Invitrogen #MPK10025 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected 500,000 ANBL6 cells with 1 ug of reporter plasmid plus 250 ng of Rinella plasmids pRL-SV40 and pGL3 control (Promega) in biological triplicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... The isolated RNAs (20 ng) were reverse-transcribed and quantitative PCR (qPCR) were perform using GoTaq Probe 1-Step RT-PCR system (Promega) in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Cells were transfected the following day with 1,000 ng of either the control plasmid or the BFP-miR-L plasmid using Fugene HD (Promega #E2311) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... the samples were diluted with seven volumes of 50 mM ammonium bicarbonate and incubated for 16 h at 37 °C with 400 ng of trypsin (ratio 1:50; “Trypsin Gold”, Promega).
-
bioRxiv - Synthetic Biology 2024Quote: ... Cells were transfected the following day with 1,000 ng of either the control plasmid or the BFP-miRNA plasmid using Fugene HD (Promega #E2311) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega) using primers (dPCR_R1_for GGACCACGCTTTCCAGAGAA ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with pCI-neo-hsSART1 full-length and ideletion mutants with 1 ng/μl using ViaFect Transfection Reagent (Promega). After 4 h incubation ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-30 ng of the original RNA was used to perform qPCR for Dkk3 and Dkk1 using GoTaq qPCR Master Mix (Promega) in a CFX96 Bio-rad system following the manufacturer’s protocol (2 min at 95°C followed by 40 cycles of denaturing at 95°C and annealing/extension at 60°C) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each well was transfected with 500 ng pGL4.22 vector with or without H1-0 promoter expression as well as 5 ng Renilla luciferase control plasmid pGL4.73 (Promega, #E6911), and 250 ng of the respective pcDNA3.1 vectors (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins bound to magnetic beads were washed twice with 100 µL of 25 mM NH4HCO3 and on-beads digested with 200 ng of trypsine/LysC (Promega) for 1 hour in 100 µL of 25 mM NH4HCO3 at room temperature ...
-
bioRxiv - Biochemistry 2024Quote: ... then resuspended in 1 gel volume of 25 mM ABC containing 5 ng/µL of digestion grade trypsin (Promega, V5111) and incubated at 37°C for 16 hours for a full digestion or for 15 minutes for a partial digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... 70 ng of a firefly luciferase reporter construct containing XPA sequences and 30 ng of the Renilla luciferase control (pRL-TK; Promega) were mixed with 0.2 µl of Jetprime transfection reagent in 10 µl of Jetprime transfection buffer (Polyplus ...
-
bioRxiv - Plant Biology 2024Quote: ... in presence of 40 U of RNase OUT (both from Invitrogen, using ∼1 μg of total RNA and 100 ng of a mixture of random hexanucleotides (Promega) and incubated for 50 min at 50 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... elution buffer I (2 M Urea, 50 mM Tris pH 7.5, 1 mM DTT and 5 ng/µl Trypsin (Promega, #V5111)) were added and samples were incubated for 1 h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 U/ml RNasin (Promega, N2611), cOmplete EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 U/ml RNasin (Promega). For cultured cells ...
-
bioRxiv - Neuroscience 2019Quote: ... 80 U/ml RNasin Plus (Promega), 40U/ml Superase-In (Life Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/mL acetylated BSA (Promega), 0.02% NP-40 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... 40U/ml RNAsin Plus (Promega N2615), 100µg/ml cycloheximide ...