Labshake search
Citations for Promega :
1101 - 1150 of 2047 citations for Pops Par Solution Unlabeled 2000 Ng Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Reduced and alkylated proteins from band slices excised from the entire separation profile were in-gel digested at 37°C overnight with 100 ng trypsin (modified sequencing grade, Promega). Supernatants were dried in a vacuum centrifuge and resuspended in 0.1% TFA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were then transiently-transfected with 100 ng/well cDNA encoding NLuc/NRP1 or NLuc/VEGFR2 using FuGENE (Promega, USA) according to the manufacturer’s instructions and incubated for a further 24h at 37°C/5% CO2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of DNase treated RNA library was added to 100 nM of Halo-tagged proteins immobilized onto magnetic resin (Promega). The volume of each binding reaction was 100µl in SEQRS buffer containing 200 ng yeast tRNA competitor and 0.1 units of RNase inhibitor (Promega) ...
-
bioRxiv - Immunology 2020Quote: ... HF and MEF cell lines were transfected with 10 ng of the internal control plasmid pTK-Renilla (pRL-TK, Promega) or 60 ng of the reporter plasmid pLUC-NF-κB (R ...
-
bioRxiv - Microbiology 2019Quote: ... Pelleted cells suspended gently in 100 μl of TEAB were mixed with 50 ng/µL of sequencing grade modified porcine trypsin (Promega), and digestions were incubated at 37 °C for 15 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells were transfected with 500 ng of 3xFLAG or 3xFLAG-PARP1 plasmids using Fugene HD transfection reagent (Promega, # E2311) according to manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Linear replicon DNA (500 ng) was added to transcription reactions at a final volume of 100 μl containing the following: Transcription Optimised Buffer (Promega), 10 mM DTT (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... Digestion was performed by adding 50 mM NH4HCO3 with 12 ng/μl sequencing-grade modified trypsin (Promega, Madison, WI, USA), incubation on ice for 4 h before overnight incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: The RT-PCR was performed using 250 ngs of total or polysomal RNA that were reverse transcribed using 50 U of Superscript II (Promega) in a total volume of 25 μL at 42 °C for 1 h ...
-
bioRxiv - Immunology 2020Quote: ... Plasmid transfections of IFITM1 3’ UTR reporter plasmids (500 ng per single well of a 6-well plate) were performed using the FuGENE 6 (Promega), according to manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... cells were transfected with a DNA mixture containing 50 ng of firefly luciferase reporter plasmid (Promega pGL4.31 [luc2P/Gal4UAS/Hygro]), 5 ng of Renilla luciferase plasmid (Promega pRL-CMV) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a membrane GFP (75 ng as control for transfection) using FuGENE HD transfection reagent (1µg DNA/1µL FuGENE) (Promega, WI, USA). Next ...
-
bioRxiv - Cell Biology 2022Quote: ... The slurry was then diluted four times with 20mM Tris-HCl with 2mM CaCl2 before digestion overnight with 100 ng sequencing grade trypsin (Promega). The samples were then centrifuged for peptide extraction from the supernatant which were then subject to liquid chromatography LC-MS (PROXEON coupled to a QExactive mass spectrometer ...
-
bioRxiv - Immunology 2022Quote: Samples were resuspended in 100µl to a final concentration of 200mM HEPES and 12 ng/µl of trypsin gold (Promega, V5280). Samples were then placed in a bioshaker (Bulldog Bio ...
-
bioRxiv - Biochemistry 2022Quote: ... Gel pieces were rehydrated with 50 mM ammonium bicarbonate containing 12.5 ng/µl modified sequencing-grade trypsin (Promega, Madison, WI) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA of 600 ng was quantified using Nanodrop and converted to cDNA using MMLV Reverse Transcriptase with random primers and RNase inhibitor (Promega). RT-qPCR was performed using SYBR Green or TaqMan Universal PCR MasterMixes (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... S2-VP10 cells were co-transfected with 0.5 μg of each luciferase reporter plasmid and 1 ng of pRL-SV40 (Promega, E2231) the day after plating (3.45 × 104 cells/well in a 24-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... Amplification was performed in 20 μl reaction volumes with 40 ng template cDNA using GoTaq® qPCR master mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... One microliter of cDNA (corresponding to 50 ng of total RNA) was amplified in 20 μL of reaction mix containing 1× Go Taq qPCR Master Mix (Promega) and 0.5 μM of each primer described in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins bound to magnetic beads were washed twice with 100 μL of 25 mM NH4HCO3 and on-beads digested with 200 ng of trypsine/LysC (Promega) for 1 hour in 100 μL of 25 mM NH4HCO3 at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA was extracted from 400 μL of each fraction (spiked with 0.2 ng exogenous control FFLuc mRNA; Promega # L4561) by adding 600 μL TRIzol (Thermo Fisher # 15596018 ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Immunology 2023Quote: ... pI.18-3xFlag-myRIG-I or pI.18-3xFlag-roRIG-I (25 ng/well each) together with transfection control pLR-SV40-Renilla (Promega) (50 ng/well ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was extracted from 400 μL of each fraction (spiked with 0.2 ng exogenous control FFLuc mRNA; Promega # L4561) by adding 600 μL TRIzol (Thermo Fisher # 15596018 ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biochemistry 2023Quote: ... The gel pieces were dehydrated using 100% ACN before 25 µl of 12 ng/µl sequence grade modified trypsin porcine (Promega) in 25 mM ABC was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 500 ng of each of the packaging plasmids were transfected into 293T cells using FuGENE 6 transfection reagent (Promega). The viral media was exchanged after 24 h ...
-
bioRxiv - Biochemistry 2023Quote: ... then alkylated (100 mM iodoacetamide in 100 mM ammonium bicarbonate at room temperature for 45 minutes) prior to in-gel trypsin digestion (30 μL of 6 ng/μL recombinant sequencing-grade trypsin (Promega) in 100 mM ammonium bicarbonate per cubed band ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 ng of either XeARPP19 or ClyARPP19 were incubated with 200 μM ATP and 25 units of recombinant bovine PKA (Promega) in PKA Buffer for 3 hours at 37°C under 1200 RPM stirring ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library preparation involved using 100 ng of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA from Promega. Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 50 ng of the plasmid encoding for the GFP-stop-Luc reporter were mixed with 1.1 μ FuGENE HD reagent (Promega), incubated for 10 min ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20-μl final volume reaction using random primers (Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... on-bead digestion was performed by addition of 100 μL trypsinization buffer (50 mM ammonium bicarbonate, Sigma and 300 ng trypsin per column, Trypsin-gold V5280 Promega) for 1 h at 23°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... The gel slices were then reduced and alkylated followed by destaining and in-gel digestion using 125 ng Trypsin/LysC (V5072, Promega) as previously described (Shevchenko ...
-
bioRxiv - Cell Biology 2022Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Genomics 2022Quote: ... Each transfection reaction consists of 20 μg of testing vector and 500 ng of Renilla-expressing phRL-TK (Promega #6251) mixed with 3.5E6 cells in buffer T using 100 μL Neon Tips (Invitrogen #MPK10025 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected 500,000 ANBL6 cells with 1 ug of reporter plasmid plus 250 ng of Rinella plasmids pRL-SV40 and pGL3 control (Promega) in biological triplicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... The isolated RNAs (20 ng) were reverse-transcribed and quantitative PCR (qPCR) were perform using GoTaq Probe 1-Step RT-PCR system (Promega) in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 20 ng of trichome DNA was amplified by combining 0.25 μM primer and 1X GoTaq Green Master Mix (Promega, USA) in a 50μl reaction volume ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-30 ng of the original RNA was used to perform qPCR for Dkk3 and Dkk1 using GoTaq qPCR Master Mix (Promega) in a CFX96 Bio-rad system following the manufacturer’s protocol (2 min at 95°C followed by 40 cycles of denaturing at 95°C and annealing/extension at 60°C) ...
-
bioRxiv - Microbiology 2023Quote: ... A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega) using primers (dPCR_R1_for GGACCACGCTTTCCAGAGAA ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 500 ng of RNA were reverse-transcribed using M-MLV Reverse Transcriptase and Random Hexamer primers (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... in-gel digestion was performed on the PNS and enriched peroxisomal membranes using 300 ng trypsin (sequencing grade modified trypsin V5111; Promega) after reduction with 10 mmol/L dithiothreitol and alkylation with 55 mmol/L iodoacetamide proteins as described previously (Wolters et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with pCI-neo-hsSART1 full-length and ideletion mutants with 1 ng/μl using ViaFect Transfection Reagent (Promega). After 4 h incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 49 ng of a TP1-Luciferase (Kurooka et al., 1998; Minoguchi et al., 1997) and 1 ng Renilla-Luciferase (pRL-TK, Promega) using Lipofectamine™ 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...