Labshake search
Citations for Promega :
1051 - 1100 of 2354 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The resulting PCR product and pHis6-Halo (Promega Corporation) were digested with PvuI and NotI and ligated to create pVJS77 that was confirmed via sequencing (Georgia Genomics Facility ...
-
bioRxiv - Biochemistry 2020Quote: PCR was performed using GoTaq Green Master Mix (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were subcloned in pGEM-T-easy (Promega) and sequenced ...
-
bioRxiv - Genetics 2021Quote: ... the coding sequence was PCR amplified from pFN31K (Promega) using forward ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR reactions were performed using GoTaq DNA Polymerase (Promega) following manufacturer protocols ...
-
bioRxiv - Genetics 2021Quote: ... PCR was performed with GoTaq DNA polymerase (Promega #M3005) using the following program ...
-
bioRxiv - Genomics 2022Quote: ... PCR was performed with GoTaq G2 DNA Polymerase (Promega) in a final volume of 40 μL containing 1 μL of total genomic DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR products were cloned into pGL4.23 vector (Promega, E841A) digested with XhoI and HindIII (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were cloned into pJET vector (Promega) and sequenced ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR amplifications were undertaken using GoTaq DNA polymerase (Promega) and PCR cycles of 95 °C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Genotyping PCRs were performed using GoTaq Green Mastermix (Promega) (Fig ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cloned into vector pGEM-T (Promega). CRISPR A and B start naturally with a 6 nt cassette consisting of adenines and guanines that we used for synchronisation of transcription (see below) ...
-
bioRxiv - Microbiology 2023Quote: ... unlabeled PCR was cloned into pGEM-T Easy (Promega) and positive clones were checked by amplification with the vector-based primers M13f and M13R.
-
bioRxiv - Physiology 2023Quote: ... The PCR products were subcloned to T-vector (Promega) and sequenced ...
-
bioRxiv - Cell Biology 2022Quote: ... After PCR clean-up (Promega #A9281, Madison, WI, USA), A-tailing of the PCR products with Taq Polymerase was performed as ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were subcloned in pGEM-T-easy (Promega) and sequenced ...
-
bioRxiv - Microbiology 2023Quote: ... Each PCR reaction contained 0.25 µl Taq polymerase (Promega), 2.5 µl 10 µM forward and reverse primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR was performed using GoTaq Flexi DNA Polymerase (Promega), and PCR products were migrated on agarose gels ...
-
bioRxiv - Cell Biology 2023Quote: ... the PCR product was cloned into pGEMTeasy (Promega A1380). The mutagenesis of the EPIYA sites were done one after the other using the kit Quick change II site-directed mutagenesis (Aligent #200523) ...
-
bioRxiv - Cell Biology 2023Quote: ... the PCR product was cloned into pGEMTeasy (Promega A1380). The cagA fragment was digested with KpnI and EagI and subcloned into the lentivirus entry vector pEF-1α/pENTR (Addgene ...
-
bioRxiv - Bioengineering 2023Quote: PCR was performed using GoTaq Flexi DNA polymerase (Promega) to amplify both junctions using primers listed in Table 1 and routinely 500 ng of genomic DNA from parental cells or each recombinant clone as template in 25 μl reactions ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... transferred to a PCR clean-up column (Promega, A9282) and centrifuged ...
-
bioRxiv - Microbiology 2023Quote: ... Each PCR reaction contained 0.25 µl Taq Polymerase (Promega), 2.5 µl 10 uM forward and reverse primers ...
-
bioRxiv - Biochemistry 2024Quote: ... the PCR products were ligated (T4 DNA ligase, Promega) into similarly restricted pYES2 ...
-
bioRxiv - Plant Biology 2024Quote: ... Genotyping PCRs were conducted using GoTaq DNA Polymerase (Promega) in accordance with the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... and a Go-Taq real-time PCR system (Promega). The data were analyzed by the ΔΔCT method and normalized to ACT1 in each sample ...
-
bioRxiv - Plant Biology 2019Quote: ... regions of 150 bp to 300 bp were amplified from the plasmids using gene specific primers (Supplementary Table 4) and the amplicons were labeled by random priming (Prime-a-Gene® Labeling System, Promega). U6 was monitored as an equal loading control.
-
bioRxiv - Pathology 2019Quote: ... Then the full DNA-A of TYLCV-C85S was amplified using the primers listed in S1 Table and inserted into the pGEM-T Easy (Promega, USA) vector to produce pGEM-1A-C85S ...
-
bioRxiv - Bioengineering 2019Quote: ... using a reaction solution consisting of RNA (100 or 200 ng) supplemented with 1 μL random primers (50 ng μL−1, Promega, C1181), 1 μL dNTPs (10 mM ...
-
bioRxiv - Developmental Biology 2019Quote: ... The DNA fragment for Island3 probe was amplified from purified genomic DNA using primers GCAGGAATGACAGACAGGCA (Fw) and ACAGAGGTGGGAACATGGAC (Rv) and cloned into pGEM-T easy vector (Promega A1360). Beta-galactosidase staining was performed as in [34] ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 ul were used as templates for PCR with the srrm3 or srrm4 primers designed to amplify the genomic region of interest (listed in Table S12) and GoTaq® Flexi DNA Polymerase kit (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... First strand cDNA was synthesized in 20 µl reaction using oligo-dt primers and ImProm-II Reverse Transcriptase (Promega, Milan, Italy) with 5 µl of RNA according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... forward and reverse primer for the individual genes of interest (Eurofins Genomics, Germany) and GoTaq qPCR 2x Master Mix (Promega, Germany). The qPCR was carried out on a RotorGene Q (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... 3 μg of total RNA was incubated with 1mM of Oligo-AP primer (Supplementary Table I) and Improm II reverse transcriptase (Promega®) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA from viral RNA or cellular transcripts were amplified using primers listed in Table S10 and GoTaq Green MasterMix (Promega®). PCR products were analysed by 1.5% agarose gel electrophoresis in TAE buffer.
-
bioRxiv - Cell Biology 2021Quote: ... was synthesized from 1 μg of total RNA, using oligo-dT primers (USB Corporation, Cleveland, USA) and a reverse transcriptase kit (ImPROm-II, Promega, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: A DNA fragment corresponding to partial f5 or f3a cDNAs was amplified from ovarian cDNAs by PCR using the gene-specific primers (see Supplemental Table 3 for detail) (28) and cloned into the pGEM-T Easy vector (Promega, USA). Correct sequence and orientations of inserts were validated by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... The analysis was performed from cDNA synthesized from RNA extractions obtained for different cellular fractions using random primers (Promega, Cat. #C1181). Unprocessed RNA levels were normalized using the mean value of three processed mRNAs.
-
bioRxiv - Immunology 2022Quote: Fragments of each gene of interest obtained by amplification of cDNA libraries using specific primers were inserted into pGEM-T Easy vectors (Promega, USA) and transformed into competent E ...
-
bioRxiv - Microbiology 2022Quote: ... In total 500 ng of RNA were reverse transcribed with SuperScript™ IV Reverse Transcriptase using Random Hexamer Primers according to the manufacturers protocol (Promega). Subsequently ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Cancer Biology 2022Quote: ... MYBL2e or CCNE1e were amplified from OE19 genomic DNA using primers containing 20 bp overlap regions with the multiple cloning site of the pGL3 Promoter vector (Promega, E1761) for luciferase assays ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... probe was generated by an in vitro transcription system using primer pairs with T7 and SP6 promoter regions (T7 and SP6 Ribomax™ large scale RNA kit, Promega) (Mlig-pro46 ...
-
bioRxiv - Cell Biology 2020Quote: ... the positive viral RNA template was amplified with CDC designed N3 gene primers and cloned into pGEM-T Easy vector (Promega, USA). The resultant plasmid DNA was linearized with PstI restriction enzyme and purified with a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 μl) were mixed with the master mixes containing 1 μl primers (10 μM each) and reagents of GoTaq G2 (Promega #M7845) and the final volume was 25 μl ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... 20 ng of cDNA of each sample was used for the qPCR reaction (duplicate/sample) with ENG or α-tubulin specific primers (Supp. Table 1) and the GoTaq qPCR Master mix (Promega), in presence of CXR reference dye ...
-
bioRxiv - Developmental Biology 2023Quote: ... reverse primer: GTT TCC TTA AGT AGC TGG GC) was cloned into the pGEM-T easy vector (Promega, Madison, WI, USA) in sense and antisense orientations ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of total RNA was reverse transcribed with M-MLV reverse transcriptase using random primers according to the manufacturer’s protocol (Promega, Madison, USA). qRT-PCR was performed in a 25 μl reaction volume containing ...