Labshake search
Citations for Promega :
951 - 1000 of 2354 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Amplicons flanking the targeting site were amplified with the following primers: Inp D447N Fw GCGGTTCTTTAGCACGGTTA and Inp D447N Rev: CTCCTCATCTCCCTCCATG using GoTaq G2 polymerase (Promega). PCR protocol ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was performed using 2 μg of total RNA and oligo(dT)20 primers with M-MLV Reverse Transcriptase (Promega). All results shown include data from three independent experiments ...
-
bioRxiv - Physiology 2021Quote: ... purified total RNA was synthesized into cDNA:RNA hybrids with Maxima H Minus Reverse Transcriptase (Thermo) and primed using equal amounts of oligo(dT)15 primers (Promega) and random hexamers (Thermo) ...
-
bioRxiv - Microbiology 2022Quote: ... using specific primers to insert MluI/NotI restriction enzyme sites and ligated on those restriction enzyme sites into pCI-Neo (Promega). All the oligonucleotides were obtained from Microsynth AG ...
-
bioRxiv - Plant Biology 2019Quote: ... using primers extended with BamHI and SacI restriction sites (GGATCCATGGA-TCATGATGCAATTA, and GAGCTCTCATGAACAACAAGG AGCC) and was subcloned into pGemT-easy (Promega). The subcloned amplicon was digested with BamHI and SacI and ligated to the BamHI-SacI digested expression vector pET24a(+)(Novagen) ...
-
bioRxiv - Genetics 2019Quote: ... A 360 bp gene-specific region of OsLUGL amplified with primers OsLUGL-PF and OsLUGL-PR (see Supplementary Table S2) was cloned into the pGEM-T Easy vector (Promega). The linearized templates were amplified from the pGEM-T plasmid containing the gene-specific region of SLG using primers Yt7 and Ysp6 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 μl of this dilution was reverse transcribed using the imProm-II system with random hexamer primers and RNasin ribonuclease inhibitor (Promega). The generated cDNA was diluted with 300 ul nuclease-free water ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The primers were designed with restriction enzyme site overhangs (BamHI and HindIII) to facilitate cloning into the pGEM-1 plasmid (Promega) (Fig ...
-
bioRxiv - Genetics 2021Quote: ... Around 1 μg total RNA was used to synthesize cDNA by using oligo-dT18 primer and Moloney murine leukemia virus reverse transcriptase (M1701, Promega). The RT-qPCR was performed using iTaq Universal SYBR Green Supermix (172-5125 ...
-
bioRxiv - Physiology 2021Quote: ... A K13 donor template consisting of a 1.5 kb region of the K13 coding region including the entire propeller domain was amplified using the primer pair p3+p4 and cloned into the pGEM T-easy vector system (Promega). This donor sequence was subjected to site-directed mutagenesis in the pGEM vector to introduce silent binding-site mutations at the Cas9 cleavage site using the primer pair p5+p6 ...
-
bioRxiv - Plant Biology 2021Quote: ... First-strand cDNA was synthesized from 2 μg total RNA using M-MLV reverse transcriptase with oligo-dT primer (Promega). Expression levels of germination-associated genes were measured by qRT-PCR analysis using LightCycler 480 SYBR Green I Master mix (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Plant Biology 2021Quote: ... The cDNAs were amplified (see Supplemental Table 3 for primer sequences) and ligated into pGEM-T vector (Promega, Madison, WI). To generate RNA substrates for EMSA ...
-
bioRxiv - Microbiology 2021Quote: ... A K13 donor template consisting of a 1.5 kb region of the K13 coding region including the entire propeller domain was amplified using the primer pair p3+p4 (Table S9) and cloned into the pGEM T-easy vector system (Promega). This donor sequence was subjected to site-directed mutagenesis in the pGEM vector to introduce silent binding-site mutations at the Cas9 cleavage site using the primer pair p5+p6 ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA of 600 ng was quantified using Nanodrop and converted to cDNA using MMLV Reverse Transcriptase with random primers and RNase inhibitor (Promega). RT-qPCR was performed using SYBR Green or TaqMan Universal PCR MasterMixes (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega).
-
bioRxiv - Plant Biology 2022Quote: ... The primer and DNA marker were end-labeled with 10 μCi of [γ-32P]ATP by T4 polynucleotide kinase (Promega) and then used for reverse transcription with avian myeloblastosis virus (AMV ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Plant Biology 2022Quote: ... The DAP-seq gDNA library was prepared using KAPA HiFi HotStart ReadyMix with unique index primers. ZmEREB57 was fused to HaloTag using the kit from pFN19K HaloTag T7 SP6 Flexi Vecto (cat. no. G184A) (Promega). ZmEREB57 fused to HaloTag was expressed using the TnT SP6 High-Yield Wheat Germ Protein Expression System (L3260 ...
-
bioRxiv - Plant Biology 2023Quote: A 265 bp PHABULOSA fragment in pGEM-T-Easy was PCR amplified with M13 primers to and used for sense and antisene in vitro transcriptions with T7 and SP6 polymerases (Promega) in the presence of 1.2 μM of α-32P-UTP (10μCi/μL ...
-
bioRxiv - Microbiology 2022Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega), resulting in the NoV-GII plasmids ...
-
bioRxiv - Developmental Biology 2023Quote: mRNA sequences were amplified from cDNA using the primers specified in Supplementary Table S3 and cloned into a PGEM-T Easy vector (Promega). Colonies containing plasmids with inserts of the right size were selected using blue-white screening ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Physiology 2023Quote: ... and reverse transcription was performed using an M-MLV reverse transcriptase with oligo-dT primers according to the manufacturer’s instructions (Promega, USA). For RT-PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 20 ng of trichome DNA was amplified by combining 0.25 μM primer and 1X GoTaq Green Master Mix (Promega, USA) in a 50μl reaction volume ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Evolutionary Biology 2023Quote: ... reverse transcription was performed using Promega’s Go-Taq 2-Step system with oligo(dT) and randomized primers as per manufacturer’s instructions (Promega, Madison, WI).
-
bioRxiv - Genomics 2023Quote: Promoters were amplified from mouse genomic DNA using primers listed in table S1 and cloned into pGL3-Basic (E1751, Promega) using SacI and BglII.
-
bioRxiv - Microbiology 2023Quote: ... Random primers were annealed to the RNA and first-strand synthesis performed with M-MLV reverse transcriptase (Promega, Wisconsin, USA). For qPCR ...
-
bioRxiv - Immunology 2023Quote: RNA from purified splenic CD8 T cells was reverse transcribed into cDNA using oligo-d(T) primers and M-MuLV reverse transcription (Promega). Real-time quantitative PCR was performed using SYBR DNA polymerase (Thermo Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 500 ng of RNA were reverse-transcribed using M-MLV Reverse Transcriptase and Random Hexamer primers (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg of RNA used as a template for cDNA synthesis with random primers and ImProm-II reverse transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2024Quote: ... For RT-qPCR four micrograms of the extracted RNA from each sample were reverse transcribed with gene specific primers using Goscript reverse transcription kit (Promega). Quantitative PCR was performed using Power SYBR Green (Life Technologies) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR reaction mixture was prepared for a 10 μL reaction volume using a GoTaq® DNA Polymerase PCR mix (Promega): 2 μL 5X Green GoTaq® Reaction Buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR reaction mixture was prepared for a 10 μL reaction volume using a GoTaq® DNA Polymerase PCR mix (Promega): 2 μL 5X Green GoTaq® Reaction Buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Duplicate PCR products from the samples were pooled and purified with the Wizard® Gel and PCR Clean-Up System (Promega), ligated and subsequently cloned into E ...
-
bioRxiv - Cell Biology 2021Quote: ... Real time quantitative PCR was performed in a CFX 96 BioRad CFX 96 Real-Time PCR detection instrument with GoTaq qRT-PCR master mix (Promega, A6002). The sequence of the primers used in this study are ...
-
bioRxiv - Microbiology 2022Quote: ... Screening for recombinant colonies was made by PCR as previously described [66] using the PCR conditions described above and the GoTag kit (Promega, M3001).
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR amplicon from the second-round PCR was gel-purified and ligated to the pGEMT- Easy vector (Promega, USA), as per the manufacturer-recommended protocol (Promega ...
-
bioRxiv - Cell Biology 2019Quote: ... were generated using PCR amplification of two DNA fragments and subsequent assembly PCR (using Pfu DNA polymerase from Promega, Mannheim, Germany) with the artificially inserted exon 9 sequence as region for annealing ...
-
bioRxiv - Microbiology 2023Quote: ... Each PCR reaction with a total volume of 25 μL contained 12.5 μL of PCR master mix (Promega; Madison, WI, USA), 8.0 μL of nuclease free water ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... Quantitative PCR (qPCR) was then performed on LightCycler 480 Real-Time PCR System using the GoTaq qPCR Master Mix (Promega, #A6001), and the primers pairs are listed in Table S7 ...
-
bioRxiv - Plant Biology 2023Quote: Stem-loop PCR and 5’-RLM-RACE PCR amplification products were purified using The Wizard® SV Gel and PCR Clean-Up System (Promega). Cloning of the different PCR products was performed as described in the pGEM®-T Vector system according to the instructoŕs instructions (Promega) ...
-
bioRxiv - Biochemistry 2023Quote: ... The linearized pMRNAXP vector and the PCR fragments of DNA encoding spike were cleaned up by Wizard® SV Gel and PCR Clean-Up System (Promega). The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... and gene expression was determined by quantitative PCR (QuantStudio 6 Pro Real-Time PCR System) with GoTag qPCR System (Promega, A6002). Actb and Rplp0 were used as housekeeping genes ...
-
bioRxiv - Genetics 2019Quote: The target genomic region was amplified using PCR and purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI). The DNA sequence of the PCR fragment was determined using cycle sequencing with BigDye v3.1 reagents (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... one microliter volumes of Reverse Transcription reactions were used as template for amplification of internal cDNA fragments using in 20 μl volume PCR reactions (35 rounds of amplification using Promega 2X PCR Master Mix (Promega, Madison, WI). Gene-specific primers and annealing temperatures are listed in Table 1 ...