Labshake search
Citations for Promega :
1201 - 1250 of 2354 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products were cloned into pGem-T Easy vectors (Promega), transformed in E ...
-
bioRxiv - Developmental Biology 2023Quote: ... Q-PCR was performed using GoTaq qPCR Master Mix (Promega) with the carboxy-X-rhodamine (CXR ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were performed using GoTaq qPCR Master Mix (Promega) and analyzed in a Step-OnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... and PCR amplified using the GoTaq qPCR system (Promega A6002) on a LightCycler 480 (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed using GoTaq qPCR Master Mix (Promega) and primers shown in S3 Table ...
-
bioRxiv - Genomics 2023Quote: qRT-PCR was performed using GoTaq qPCR Master Mix (Promega) per the manufacturer’s in-structions on a CFX Connect Real-Time PCR system (BioRad ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCRs were performed with GoTaq polymerase (Promega, Madison, WI, USA) using 7.5 ng cDNA as template ...
-
bioRxiv - Microbiology 2023Quote: ... Colony PCRs were performed with GoTaq® G2 Mastermix (Promega). Restriction enzymes and T4 DNA ligase were provided by New England Biolabs and Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2023Quote: PCR reactions were ligated to pGEM T-Easy plasmid (Promega). Closed inserts were Sanger sequenced by the UChicago Comprehensive Cancer Center DNA Sequencing Facility ...
-
bioRxiv - Synthetic Biology 2023Quote: ... After the purification using Wizard SV PCR cleanup system (Promega), 0.18 pmol of the insert DNA fragment and 0.02 pmol of the vector DNA fragment were directly electroporated into REK13 mutant cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... SYBRgreen-based GoTaq 1-Step qRT-PCR System (Promega #A6020) and LightCycler 96 software was used for RNA quantification ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR was performed with GoTaq Green Master Mix (Promega; #M7121) following a standard protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... the resulting PCR products were subcloned into either pFN21A (Promega) or Halo pcDNA5/FRT PacI PmeI (described previously (76)) ...
-
bioRxiv - Immunology 2024Quote: ... qRT- PCR was performed using GoTaq qPCR master mix (Promega) and primers specific for LRBA (forward ...
-
bioRxiv - Cancer Biology 2024Quote: ... Analyses were carried out using Promega PCR master mix (Promega) on an LC-480 Real-Time PCR system (Roche) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR were carried out with Green Taq DNA polymerase (Promega) on cDNA using primers described in Table S4 ...
-
Exploring the interspecific interactions and the metabolome of the soil isolate Hylemonella gracilisbioRxiv - Microbiology 2022Quote: ... gracilis 16S rRNA PCR was performed from grown colonies in a 50 μl PCR-GoTaq™ green master mix (Promega Corp. Madison, USA cat# M712). For 16S rRNA gene amplification the following primers were used ...
-
bioRxiv - Plant Biology 2020Quote: ... corniculatus plants was synthesized from 3 μg of total RNA using a Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) (Promega, WI, USA) and 100 pmol of random hexamers (Pharmacia Biotech) ...
-
bioRxiv - Biochemistry 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (MMLV-RT) enzyme and recombinant RNasin® ribonuclease inhibitor were purchased from Promega (Madison, WI, USA). Evagreen 2X qPCR MasterMix was purchased from Applied Biological Materials Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... AtLPAAT4 and AtLPAAT5 by RT-qPCRs were performed with the Bio-Rad CFX96 real-time system using GoTaq® qPCR Master mix (Promega # A6002). The specific primer pairs used for AtLPAAT2 ...
-
bioRxiv - Microbiology 2020Quote: ... for gram-negative bacteria and cDNA library preparation was performed using the GoTaq® 2-Step RT-qPCR System (A6010, Promega, USA). The RT-PCR was done using the Applied Biosystems™ 7500 Real-Time PCR System and primers shown in the supplementary data table S2 (35-38) ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was read after 2 minutes shaking on an orbital shaker and 10 min incubation at RT using the GloMax instrument (Promega, Madison, USA).
-
bioRxiv - Immunology 2022Quote: ... the buffer was diluted with 50 mM ABC to a final of 2M urea and digested overnight at RT with 1 µg trypsin (Promega, Walldorf, Germany). On the next day ...
-
bioRxiv - Microbiology 2024Quote: ... followed by reverse transcription to complementary DNA (cDNA) using 30 enzyme units(U) of the Moloney Murine Leukemia Virus reverse transcriptase (MMLV-RT) (Promega, WI, USA). The extension products were then analysed using the ABI3730xl DNA Analyzer (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... Approximately 3 μg of DNase I-treated RNA was reverse transcribed to cDNA using 10 μM of oligo (dT) primer and M-MLV reverse transcriptase (Promega, Madison, WI USA) in a 20 μL reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the first-strand cDNA was synthesized from 1 μg of total RNA with oligo dT or random primers using ImProm-II reverse transcriptase (Promega, Madison, WI, USA). The qPCR reactions were performed in a 20 μL reaction mixture using SYBR Green PCR Master Mix (Roche ...
-
bioRxiv - Plant Biology 2021Quote: The cDNAs corresponding to the two alleles of SoIAA2 were cloned into a pFN2A (GST) flexi vector (Promega – primers in Supplementary Table 1), expressed in E ...
-
bioRxiv - Plant Biology 2020Quote: ... First strand cDNA synthesis was carried out using 2 ug of total RNA and reverse transcription was performed using an oligo (dT) 15 primer and Moloney murine leukemia virus (MMLV) reverse transcriptase (Promega, Madison, WI, USA). qPCR was carried out using SYBR GREEN PCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Synthesis of cDNA was performed using 250 ng of purified RNA using oligo(dT)15 primers (GoScriptTM Reverse Transcription System, A5001, Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: ... The partial sequence encoding the nucleoprotein from HPWMoV was amplified using specific primers (Table 1) from two-fold diluted cDNA with GoTaq® Flexi DNA polymerase (Promega, WI, USA) with the following reaction conditions ...
-
bioRxiv - Genomics 2020Quote: ... Five micrograms of RNA was reverse transcribed into cDNA using Moloney-murine leukemia virus reverse transcriptase and random primers (Promega, Madison, Wisconsin, USA) in a 20 μl reaction volume ...
-
bioRxiv - Microbiology 2020Quote: ... The standard was created with above-mentioned primers by amplifying mcrA genes from cow rumen fluid [19] and cloning them into the pGEM®-Teasy vector system (Promega, Mannheim, Germany). Amplicons for mcrA standard were generated with vector-specific primers sp6 and T7 and the resulting PCR product was cleaned with DNA purification kit (Biozym ...
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Plant Biology 2023Quote: ... First strand cDNA was synthesised from 500 ng of total RNA using the GoScriptTM Reverse Transcription System and oligo (dT)15 primers (Promega Madison, WI, USA) according to their instructions with the optional addition of RiboLock RNase inhibitor (20 units ...
-
bioRxiv - Plant Biology 2020Quote: ... the PCR products were cloned into pGEM-T Easy plasmid (Promega) for propagation and sequencing (GATC Biotech ...
-
bioRxiv - Cell Biology 2020Quote: ... the PCR products were cloned into the pGEM-T vector (Promega). Sequencing of the inserts from a dozen of subclones in each case allowed us to ascertain the edits in TMEM70 exons ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products were subcloned into the pGEM-T Easy vector (Promega) and the inserts were sequenced.
-
bioRxiv - Genetics 2021Quote: ... PCR were performed with the kit GoTaq® Flexi (Promega, USA) using 20 ng DNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... This was purified using a PCR clean up kit (Promega, A9281). The sgRNAs were synthesized using the MEGAscript™ T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR products were inserted into pGEM-T Easy vector (Promega). Sequences encoding the full length and parts of Tdrd3 were cloned into pCS2-Flag-N or pCS2-Flag-C to produce Tdrd3 fused with Flag at the N- or C-terminus of Tdrd3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The nested PCR products were cloned into pGEM-T vector (Promega) and the nucleotide sequence was determined by Sanger sequencing ...
-
bioRxiv - Genetics 2019Quote: ... (2003) using the GoTaq® PCR Core System I (Promega, USA). The following primer sequences were used ...
-
bioRxiv - Immunology 2020Quote: ... and real-time PCR performed using GoTaq qPCR Master mix (Promega) on ABI QuantStudio 7 Flex Real Time PCR System ...
-
bioRxiv - Neuroscience 2021Quote: ... site-directed mutagenesis was performed using PCR with Pfu polymerase (Promega; mutagenesis primers 5’ to 3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using GoTaq G2 (M7845, Promega, Madison, WI, USA) according to manufacturer’s instructions with the primers Dsg2-W2A for ...
-
bioRxiv - Cell Biology 2021Quote: ... Qualitative PCR was performed with GoTaq® qPCR Master Mix (Promega) and a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2021Quote: ... purified using Wizard SV Gel and PCR Clean-Up System (Promega), and all 4 reactions were pooled together ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR amplicon obtained was ligated to pGEM-T Easy vector (Promega). Competent cells E ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the GoScriptTM Reverse Transcription System (Promega) and a C1000 Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were cloned using the pGEM-T Easy System (Promega) and sequence determined by Sanger sequencing (Eurofins Genomics ...