Labshake search
Citations for Promega :
801 - 850 of 1480 citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: U2OS cells (40,000 cells/well) were reverse transfected with FlavER plasmid using Fugene HD (Promega) in an 8-well chamber slide (Celltreat) ...
-
bioRxiv - Cell Biology 2022Quote: Transcription of pGEM plasmids in vitro was carried out according to the manufacturer’s instructions (Promega) using SP6 polymerase ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids were purified using the Wizard Plus mini-prep DNA purification system (Promega, Madison, WI) and screened for WT- and I212F-mutated allele strands by dual digestion analysis using EcoRI digestion (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected with 0.5 μg AsCpf1 or SpCas9 plasmid using Fugene 6 transfection reagent (Promega) according to manufacturer’s guideline ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... coli strains were performed using the PureYield™ Plasmid Miniprep System (Promega Corp., Madison, WI) according to manufacturer protocols ...
-
bioRxiv - Immunology 2023Quote: ... was inserted upstream of the luc2 gene in the pGL4.10[luc2] plasmid (Promega Cat. E6651). As the SNP was located within the promoter region ...
-
bioRxiv - Immunology 2023Quote: ... was inserted upstream of the luc2 gene in the pGL4.10[luc2] plasmid (Promega Cat. E6651). Following this step ...
-
bioRxiv - Immunology 2023Quote: ... Cells were transfected with a total of 4.5 µg plasmid DNA using Fugene HD (Promega): 0.25µg envelope vector pMD2.G (RRID:Addgene_12259) ...
-
bioRxiv - Neuroscience 2023Quote: ... Both HEK293T cells and N2A cells were transfected with indicated plasmids via Fugene (Promega, E2311) as previously described46 ...
-
bioRxiv - Neuroscience 2023Quote: ... plus helper plasmids pVSV-G (18 mg) and psPAX2 (27 mg) using FuGENE HD (Promega). DNA was incubated with 210 ml FuGENE HD in 4.5 ml Opti-MEM (Life Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid-based donor repair templates for CRISPR were prepared in pGEM-T Easy vector (Promega). Homology arms (each around 800-1000 bp ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids pKHNH6 and pKHNH3 were linearised prior to transformation using restriction enzymes EcoRV (Promega, USA) and KpnI (Fisher ...
-
bioRxiv - Physiology 2023Quote: Expression plasmids for luciferase and FincoR were mixed with a Coupled Reticulocyte Lysate System (Promega). After incubating at 30°C for 60 min ...
-
bioRxiv - Plant Biology 2023Quote: High concentration (1 µg/µL) plasmid DNA was extracted via maxi-prep (Promega SV Wizard). Lower quality plasmid DNA (e.g ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid constructs were acutely transfected into HEK293 cells using Viafect reagent (E4981; Promega, Madison, WI), following the manufacture’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR products of nifH and rnpB were each cloned into the pGEM-T plasmid (Promega). cDNA concentrations in nanograms per microliter were measured by Qubit 2.0 fluorometer (invitogen) ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... MCF-10A cells were transfected with the plasmids with the use of ViaFect (Promega, E4982). GFP-expressing cells were sorted into single-cell clones by flow cytometry with a Moflo Astrios EQ instrument (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were transfected with 2 µg of plasmids with FuGene HD transfection reagent (Promega #E2312) overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified 5 μg of pAd/CMV/V5-DEST plasmid was transfected using Fugene HD (Promega) when the 293A cells were 80% confluent ...
-
bioRxiv - Developmental Biology 2024Quote: ... Kanamycin-resistant colonies were selected and cultured o/n purified with Plasmid Miniprep system (Promega) and verified by sequencing (Microsynth ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmids were extracted using Wizard® Plus SV Minipreps DNA Purification System Kit from Promega as per the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Each enhancer or promoter region was amplified from human genomic DNA and cloned into pGL4.10 [luc2] (Promega) containing a SNP (rs718960 ...
-
bioRxiv - Microbiology 2020Quote: ... albicans to damage human vascular endothelial cells was assessed by the CytoTox-96 assay (Promega, Madison, WI), which measures the release of lactate dehydrogenase (LDH ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK 293T cells were co-transfected with human MOR and a luciferase-based cAMP biosensor (GloSensorTM, Promega). The next day ...
-
bioRxiv - Genetics 2022Quote: We performed transient transfection on human pluripotent stem cells using FuGENE® HD Transfection Reagent (Promega, E2311). The cells were splitted and treated with Y-27632 for one before transfection.
-
bioRxiv - Molecular Biology 2023Quote: ... 15 mg of His-Tev-HaloTag-(3C)-human γ-TuNA was coupled to Halo Magne beads (Promega). Xenopus laevis egg extract was prepared by standard methods28 ...
-
bioRxiv - Genomics 2023Quote: ... Primer efficiency was calculated using a 10-fold serial dilution of Human Mixed Genomic DNA (Promega G3041). For primer sequences and calculated efficiencies ...
-
bioRxiv - Cell Biology 2024Quote: All human cell lines were authenticated at each batch freezing by STR profiling (StemElite ID System, Promega). All cell lines were tested for mycoplasma at each batch freezing by PCR (32 ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with pAV-Tornado-RhoBAST plasmid (~200 ng/well) using FuGeneHD transfection reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected with reporter plasmid and various Nsp1 constructs using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Dual Luciferase Assay System (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... The calibration curves were generated using serial dilutions of pGEM-T Easy plasmid DNA (Promega, USA) carrying a single copy of the target gene fragment (qp1F/qp1R) ...
-
bioRxiv - Genomics 2020Quote: ... 300ng of plasmid DNA for each biological replicate was transfected into HepG2 cells using FuGENE (Promega) in triplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with plasmids encoding fluorescently tagged proteins using FuGENE® HD Transfection Reagent (Promega), following manufacturer’s protocol and assayed 1-3 days after transfection ...
-
bioRxiv - Immunology 2019Quote: ... CHO-K1 cells (European Collection of Cell Cultures) were stably transfected with plasmids using FuGene (Promega), stable cell lines were created ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the plasmid DNA was purified using the Wizard Plus SV Minipreps DNA Purification System (Promega) or QIAGEN Plasmid Midi kits.
-
bioRxiv - Microbiology 2019Quote: ... The hbdH gene was excised from a sequence verified plasmid using restriction endonucleases (Promega, Madison, WI). The expression vector pET45b (Novagen ...
-
bioRxiv - Genomics 2019Quote: The PCR products were excised from agarose gels and ligated into pGEM-T vector plasmids (Promega) with T4 DNA ligase (Promega) ...
-
bioRxiv - Physiology 2019Quote: ... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ...
-
bioRxiv - Genomics 2019Quote: ... 2 μg of each of these reporter plasmids along with 100 ng of pRL-TK (Promega), a Renilla luciferase expression plasmid to control for transfection efficiency ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.34 vector plasmid containing the CArG box (SRF response element) was purchased from Promega (Cat.E1350). An empty vector was generated by removing the SRF response element ...
-
bioRxiv - Cell Biology 2019Quote: ... These reporter vectors were transfected into HepG2 cells along with a β-galactosidase control plasmid (Promega) to normalize transfection efficiency ...
-
bioRxiv - Immunology 2021Quote: pCIneo Precursor miR-146a (pmiR-146a) and HA-HuR plasmids were transfected using Fugene HD (Promega) for RAW264.7 cells as described previously (Goswami et.al ...
-
bioRxiv - Biochemistry 2020Quote: ... subjected for mini-prep plasmid purification by Wizard® Plus Minipreps DNA Purification System (Promega, USA), and used as the template in subsequent PCR amplification of the given library ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was used to combine the two split EPG sections with N-Terminal HaloTag Plasmid PHTN (Promega) such that the N-terminal HaloTag sequence is preceded by the signal sequence at its 5’ end and succeeded by the rest of the EPG sequence at the 3’ end ...
-
bioRxiv - Microbiology 2021Quote: ... The reporter plasmid pAP1-Luc and promoterless-RLuc (pGL4.70) were purchased from Promega (Madison, WI, USA).
-
bioRxiv - Microbiology 2021Quote: All virus stocks were produced by plasmid transfection of HEK 293T cells with Fugene 6 (Promega). Supernatants were harvested at 48h and 72h ...
-
bioRxiv - Cell Biology 2021Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-up system (Promega). A guide sequence (TATTCGAGGCCATCGTGTACCGG ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with Galectin-3-GFP plasmid (0.5 µg) using FuGene HD (Promega, Madison, WI) with a ratio of 3:1 for 24 h at 37 °C in 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were transiently transfected with 50 ng each of the appropriate plasmids using FuGENE HD (Promega) at a FuGENE DNA ratio of 3:1 ...