Labshake search
Citations for Promega :
8251 - 8300 of 8541 citations for Nitrite Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... and 100 μl sample volumes were assayed in triplicate for ATP content using the BacTiter-Glo bioluminescence kit (Promega, Mannheim, Germany). After 5 min incubation in the dark to allow for the decay of plate autofluorescence ...
-
bioRxiv - Plant Biology 2021Quote: ... Aliquots of 50 µl were analyzed in triplicate for NAD+ and NADH with the NAD/NADH-Glo Kit (Promega, Mannheim, Germany) in white 96-well plates using a Synergy HTX microplate reader ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of all the pOXA-48 bearing strains was isolated using the Wizard genomic DNA purification kit (Promega, WI, USA), and quantified using the QuantiFluor dsDNA system (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 min while orbital shaking and using 20 μL of lysate with 20 μL of Luciferase Kit substrate (Promega, E1501).
-
bioRxiv - Cancer Biology 2020Quote: ... Plates containing the different transfected cells were incubated for 24 hours at 37°C before the luciferase activity was measured using the Dual-Glo luciferase detection kit (Promega: E2920).
-
bioRxiv - Microbiology 2022Quote: ... Screening for recombinant colonies was made by PCR as previously described [66] using the PCR conditions described above and the GoTag kit (Promega, M3001).
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted from viral transport medium or directly from tracheal aspirates by Maxwell® RSC Blood DNA Kit per manufacturer’s instructions (Promega Corporation). RNase A was added to samples to remove potential viral RNA ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified by Quantus™ Fluorometer (Promega, USA). Purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina MiSeq PE300 platform (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial counts were obtained by comparing the signals from the tested samples with a standard curve prepared by serial dilutions of a standard sample purified using the WizardSV Gel and PCR Clean-Up System Kit (Promega, USA) and subsequently cloned into the pGEM-T vector (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... probe was generated by an in vitro transcription system using primer pairs with T7 and SP6 promoter regions (T7 and SP6 Ribomax™ large scale RNA kit, Promega) (Mlig-pro46 ...
-
bioRxiv - Plant Biology 2019Quote: ... Grown cultures were used for DNA isolation using Wizard Genomic DNA Purification Kit following the manufacturer’s instructional manual (Promega, Madison, WI).
-
bioRxiv - Physiology 2019Quote: In vitro transcription was performed using T3 RNA polymerase and other reagents supplied in the RiboProbe In Vitro Transcription System kit (Promega, Italy) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Root tissue was ground in liquid nitrogen and total RNA was extracted with the Maxwell® 16 LEV plant RNA kit (Promega) in the Maxwell 16 AS2000 instrument (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Pathology 2020Quote: Total mRNA was isolated from tissues using a Maxwell® LEV simply RNA Cells/Tissue kit (cat# AS1280, Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from samples using Maxwell® 16 automated system (Maxwell® 16 Cell DNA kits, Promega, Madison, WI, USA). Extracted DNA samples were quantified using NanoDropTM 2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we found we did not obtain clean results unless we first used a genomic miniprep kit to purify DNA (Promega Wizard). We inverted the colors for all agarose gels to assist visualization.
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: RNA was isolated from single pupal terminal samples dissected at 24 hours APF or 28 hours APF using the Maxwell® 16 Tissue DNA Purification Kit (Promega). Poly-A RNA-seq libraries were generated using a Clontech library preparation kit (040215) ...
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The resulting PCR products were extracted from 2% agarose gel and further purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences) and were quantified by QuantiFluor™-ST (Promega).
-
bioRxiv - Plant Biology 2019Quote: ... The PCR products were purified using a HiPure Gel Pure DNA Mini Kit (Magen, D2111) and cloned into the pGEM-T Easy Vector (Promega, A1360). For each sample ...
-
bioRxiv - Genomics 2021Quote: ... the strain was cultivated on PD2 medium as described (Su et al., 2016) for DNA extraction using Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2020Quote: Yeast genomic DNA was prepared from 1 ml cultures grown in rich media from single colonies or Ade− half-sectors using the Wizard® Genomic DNA Purification Kit (Promega). Genomic DNA (150 ng ...
-
bioRxiv - Genetics 2020Quote: Molecular confirmation of HDR-mediated target site integration of the Reckh cargo was performed on genomic DNA extracted from single GFP+ black-eyed individuals using the Wizard® genomic DNA purification kit (Promega). Primers Kh1-ext-fw (CACTGTTGGCACTCCATCTG ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified using Quantus™ Fluorometer (Promega, USA). The qualified PCR products were mixed ...
-
bioRxiv - Cancer Biology 2020Quote: To isolate RNA from cell lines we followed the manufacturer's instructions of the Maxwell 16 LEV simply RNA Kit (# AS1280) (Promega, Walldorf, Germany). Quantification of mRNA was performed using the BRYT Green® Dye (GoTaq® qPCR ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from cultured cells or frozen adipose tissue using the Eastep Super Total RNA Extraction Kit (Promega (Beijing) Biotech Co. ...
-
bioRxiv - Microbiology 2021Quote: ... supernatant was harvested from Calu-3 cells and inactivated by addition of lysis buffer (Maxwell 16 viral total nucleic acid purification kit, Promega #AS1150) complemented with proteinase K ...
-
bioRxiv - Microbiology 2021Quote: RNA from lysed and heat-inactivated samples was purified according to the instructions of the manufacturer using Maxwell 16 viral total nucleic acid purification kit (Promega, #AS1150) or Maxwell 16 LEV simplyRNA cell kit (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2021Quote: ... small leaves and witches’ broom) (Figure 1B) were collected for total genomic DNA extraction using the Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2019Quote: ... with a Maxwell 16 instrument using Maxwell 16 LEV SimplyRNA Blood kits according to the manufacturer’s protocol (Promega, Madison, WI, USA). Complementary DNA (cDNA ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from the aerial portions of 10-day old seedlings using the Wizard® Genomic DNA Purification Kit (Promega) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The radioactively labeled probe was first prepared with γ[32 P]ATP ATP and DNA oligonucleotides listed in Supplementary Table S5 with a T4 polynucleotide kinase kit (Promega), purified on MicroSpin G-25 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from each lung homogenate and nasal wash was isolated using the Maxwell RSC Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega Corporation), following the manufacturer’s suggested protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... The first strand cDNA was reverse transcribed from the RNA templates using the GoScript Reverse Transcription system kit (Promega, United States) and Oligo(dT)15 primers (Promega ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from fBECs of WT and Gpr126iECKO mice at P18 using Maxwell RSC simplyRNA tissue kits with the Maxwell RSC Instruments (Promega Corporation). The amount of RNA was measured using the Nanodrop technique and its integrity assessed using Agilent Bioanalyzer 2100 with Nano RNA kits (RIN > 8) ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from fBECs from WT and Gpr126iECKO mice at P18 using Maxwell RSC simplyRNA tissue kits with a Maxwell RSC instrument (Promega Corporation). The amount of RNA was measured using the Nanodrop technique and reverse transcribed with random hexamers (High-Capacity cDNA Archive kits ...
-
bioRxiv - Genomics 2022Quote: ... The efficiency and specificity of the designed primers was tested through PCR using the GoTaq Green Master kit (Promega, Madison, USA) with thermal cycling conditions of 2 min at 95 °C ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from a piece of caudal fin using a Maxwell® RSC Blood DNA Kit (Promega, Madison, WI, USA). Extractions were performed following the manufacturer’s instructions with the exception of a longer two-hour lysis step ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... H12) of each 96 well plate were pooled prior to DNA extraction using Wizard Genomic DNA purification kit (Promega, Madison, Wisconsin). The P0 region including the beginning of galK was amplified for 25 PCR cycles using primers deep_seq_Fw and deep_seq_Rv carrying 5’ adaptors for Illumina sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mycelium was harvested and then used in the RNA extraction following the protocol provided in the Maxwell® 16 LEV simplyRNA Cells Kit (Promega). RNA concentrations were measured by NanoDrop and purified RNA was stored at -80°C ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were then pelleted and used for genome extraction using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) and Qiaquick PCR purification kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Microbiology 2023Quote: ... One aliquot was used for DNA extraction using the Promega Wizard® Genomic DNA Purification kit (Promega Corporation, Madison, WI, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... of virus pool stock was used for viral RNA extraction by GeneAid viral RNA extraction kit (GeneAid) and converted to cDNA using ImProm-II™ reverse transcription system (Promega) according to manufacturers’ protocols ...