Labshake search
Citations for Promega :
7901 - 7950 of 8213 citations for QuantiChrom Indole Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... of G1 and G2 mosquitoes fluorescently expressing the actin5c::eCFP construct was extracted as individual samples using the Wizard® Genomic DNA Purification Kit (Promega). Regions of gDNA were then amplified according to the three primer pairs as indicated in Fig ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 ul were used as templates for PCR with the srrm3 or srrm4 primers designed to amplify the genomic region of interest (listed in Table S12) and GoTaq® Flexi DNA Polymerase kit (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... liquid cultures were pelleted at 3000 g for 10 minutes and miniprepped using the Tecan Fluent robotic liquid handler with Promega Wizard SV 96 Plasmid DNA Purification Kit (Promega; A2250).
-
bioRxiv - Immunology 2021Quote: Around 1×105 cells were treated as indicated prior to lysis and RNA isolation using the ReliaPrep™ RNA Miniprep kit (Promega). Approximately 1μg of total RNA was reverse transcribed into cDNA using SuperScript III (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: miRNAs were isolated from ultracentifuged EVs resuspended in 25 ul of phosphate buffered saline (PBS) using the Maxwell® RSC miRNA Plasma and Serum Kit (AS1680, Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... The duplicate amplification products of each sample were pooled and purified with the SV Wizard PCR Purification kit (Promega, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... hLamp1-mCherry (this study) were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B), and diluted to 30–80ng/μl for injection into embryos ...
-
bioRxiv - Developmental Biology 2020Quote: ... The α-tub∷GFP (Chung et al., 2014) plasmid was injected at 5-10ng/μl after purification using the PureYield Midiprep kit (Promega, #A2492).
-
bioRxiv - Zoology 2021Quote: ... The PCR products were detected through 2% agarose gel electrophoresis and purified with an AxyPrep DNA gel recovery kit (Axygen Biosciences, Union City, CA, USA) and then quantified with a QuantiFluor(tm)-ST blue fluorescence quantitative system (Promega, USA). Purified amplicons were pooled in equimolar amounts ...
-
bioRxiv - Cell Biology 2021Quote: In vitro translated (IVT) proteins were generated in rabbit reticulocyte lysate using the SP6 TNT Quick-Coupled Transcription/Translation kit (Promega, L2080) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... PCR fragments amplified from genomic DNA extracted from the different founder mice using the Wizard SV genomic DNA extraction kit (Promega, A2360), were cloned into a vector using the TOPO TA cloning kit (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... was synthesized from 1 μg of total RNA, using oligo-dT primers (USB Corporation, Cleveland, USA) and a reverse transcriptase kit (ImPROm-II, Promega, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from lung tissue using the Maxwell automated instrument and the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega). The concentration of RNA and quality were measured with HS Total RNA 15nt.methods (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... GB02 and GB03 using the Maxwell® 16 Instrument with the Maxwell® 16 Tissue DNA Purification Kit (Promega, Madison, WI). DNA concentration was determined using the Qubit Fluorometer (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 1/6th of the diaphragm) using a Maxwell RSC Instrument and Maxwell RSC simplyRNA Tissue Kit (both Promega, Southampton, UK) and complementary DNA (cDNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The yeast colony was grown overnight in 10 ml of YPD and the gDNA was extracted using the Wizard Genomic DNA Isolation kit (Promega, Switzerland). The PCR reaction was as follows ...
-
bioRxiv - Molecular Biology 2022Quote: DNA extraction was also done for all the samples using the Wizard® Genomic DNA Purification Kit according to the manufacturer’s protocol (Cat#A1120, Promega USA).The eluted DNA was quantified by QuantusTM Fluorometer® (Cat# E6150 Promega Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... the cells were lysed and firefly and Renilla luminescence were measured following the manufacturer’s directions (Dual luciferase kit, Promega, Madison, WI) on a luminometer (GloMax® 20/20 Luminometer ...
-
bioRxiv - Genomics 2022Quote: ... The liquid cultures were centrifuged at 10,000 rpm and DNA was extracted from the pelleted cells using Wizard DNA purification kit (Promega, Madison, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 5 mL of overnight cultures using the Wizard Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) and DNA concentration was measured using a Qubit™ Fluorometer and Nanodrop 2000 (Thermo Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Remaining ATP was readout after 3 h incubation using Kinase-Glo® Luminescent Kinase kit following manufacturer’s instructions (Promega, WI, USA).
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Plant Biology 2021Quote: ... and 100 μl sample volumes were assayed in triplicate for ATP content using the BacTiter-Glo bioluminescence kit (Promega, Mannheim, Germany). After 5 min incubation in the dark to allow for the decay of plate autofluorescence ...
-
bioRxiv - Plant Biology 2021Quote: ... Aliquots of 50 µl were analyzed in triplicate for NAD+ and NADH with the NAD/NADH-Glo Kit (Promega, Mannheim, Germany) in white 96-well plates using a Synergy HTX microplate reader ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of all the pOXA-48 bearing strains was isolated using the Wizard genomic DNA purification kit (Promega, WI, USA), and quantified using the QuantiFluor dsDNA system (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 min while orbital shaking and using 20 μL of lysate with 20 μL of Luciferase Kit substrate (Promega, E1501).
-
bioRxiv - Cancer Biology 2020Quote: ... Plates containing the different transfected cells were incubated for 24 hours at 37°C before the luciferase activity was measured using the Dual-Glo luciferase detection kit (Promega: E2920).
-
bioRxiv - Microbiology 2022Quote: ... Screening for recombinant colonies was made by PCR as previously described [66] using the PCR conditions described above and the GoTag kit (Promega, M3001).
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted from viral transport medium or directly from tracheal aspirates by Maxwell® RSC Blood DNA Kit per manufacturer’s instructions (Promega Corporation). RNase A was added to samples to remove potential viral RNA ...
-
bioRxiv - Immunology 2022Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified by Quantus™ Fluorometer (Promega, USA). Purified amplicons were pooled in equimolar amounts and paired-end sequenced on an Illumina MiSeq PE300 platform (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial counts were obtained by comparing the signals from the tested samples with a standard curve prepared by serial dilutions of a standard sample purified using the WizardSV Gel and PCR Clean-Up System Kit (Promega, USA) and subsequently cloned into the pGEM-T vector (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... probe was generated by an in vitro transcription system using primer pairs with T7 and SP6 promoter regions (T7 and SP6 Ribomax™ large scale RNA kit, Promega) (Mlig-pro46 ...
-
bioRxiv - Plant Biology 2019Quote: ... Grown cultures were used for DNA isolation using Wizard Genomic DNA Purification Kit following the manufacturer’s instructional manual (Promega, Madison, WI).
-
bioRxiv - Physiology 2019Quote: In vitro transcription was performed using T3 RNA polymerase and other reagents supplied in the RiboProbe In Vitro Transcription System kit (Promega, Italy) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Root tissue was ground in liquid nitrogen and total RNA was extracted with the Maxwell® 16 LEV plant RNA kit (Promega) in the Maxwell 16 AS2000 instrument (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Pathology 2020Quote: Total mRNA was isolated from tissues using a Maxwell® LEV simply RNA Cells/Tissue kit (cat# AS1280, Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from samples using Maxwell® 16 automated system (Maxwell® 16 Cell DNA kits, Promega, Madison, WI, USA). Extracted DNA samples were quantified using NanoDropTM 2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we found we did not obtain clean results unless we first used a genomic miniprep kit to purify DNA (Promega Wizard). We inverted the colors for all agarose gels to assist visualization.
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: RNA was isolated from single pupal terminal samples dissected at 24 hours APF or 28 hours APF using the Maxwell® 16 Tissue DNA Purification Kit (Promega). Poly-A RNA-seq libraries were generated using a Clontech library preparation kit (040215) ...
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The resulting PCR products were extracted from 2% agarose gel and further purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences) and were quantified by QuantiFluor™-ST (Promega).
-
bioRxiv - Plant Biology 2019Quote: ... The PCR products were purified using a HiPure Gel Pure DNA Mini Kit (Magen, D2111) and cloned into the pGEM-T Easy Vector (Promega, A1360). For each sample ...
-
bioRxiv - Genomics 2021Quote: ... the strain was cultivated on PD2 medium as described (Su et al., 2016) for DNA extraction using Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2020Quote: Yeast genomic DNA was prepared from 1 ml cultures grown in rich media from single colonies or Ade− half-sectors using the Wizard® Genomic DNA Purification Kit (Promega). Genomic DNA (150 ng ...
-
bioRxiv - Genetics 2020Quote: Molecular confirmation of HDR-mediated target site integration of the Reckh cargo was performed on genomic DNA extracted from single GFP+ black-eyed individuals using the Wizard® genomic DNA purification kit (Promega). Primers Kh1-ext-fw (CACTGTTGGCACTCCATCTG ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified using Quantus™ Fluorometer (Promega, USA). The qualified PCR products were mixed ...