Labshake search
Citations for Promega :
7701 - 7750 of 8213 citations for QuantiChrom Indole Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... MT4 and TMZR5 cells were transduced with the genes in Fig 2G as before and 96 hours post-transduction the supernatants were harvested to measure toxicity of the expressed ISGs using the CytoTox-Glow kit (Promega). In a separate experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... phaffii cells were cultured for 12-14 h and total RNA was isolated using RNA isolation kit (Cat. # Z3100, Promega) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: gDNA was extracted from stationary phase evolved cocultures following revival from frozen stocks using a Wizard Genomic DNA purification Kit (Promega). DNA fragment libraries were constructed for samples from shaking WT-based cocultures A-F and NifA*-based cocultures M-R at generation ∼146 using NextFlex Bioo Rapid DNA kit ...
-
bioRxiv - Microbiology 2019Quote: ... the aptamer pool from the 10th round of SELEX was cloned with the pGEMT-easy Cloning and Ligation Kit (Promega). To investigate the effect of counter-selection on the aptamer pools ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA was extracted from loopfuls of pure MTBC colonies grown on Lowenstein-Jensen media (37) using the Maxwell 16 DNA Purification Kit (Promega). DNA from Nigerian strains was extracted using the Cetyl trimethylammonium bromide (CTAB ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA from Proteinase K-digested mouse toes was extracted using the Wizard SV genomic DNA extraction kit (Promega, A2360). PCR reactions to amplify a fragment containing the target sites were carried out using the forward and reverse primers (Forward primer ...
-
bioRxiv - Cell Biology 2021Quote: ... The RNA concentrations were measured and 1ug RNAs were used to synthesize cDNA using the GoScript Reverse Transcription System kit(Promega).
-
bioRxiv - Cancer Biology 2021Quote: ... cells using ITX2 transfection reagent and luciferase activity (renilla and firefly) was measured 24hours later with the Dual Glow-Stop and Glow luciferase kit (Promega) using a BioTek luminometer (Synergy).
-
bioRxiv - Cancer Biology 2021Quote: ... The desired PCR fragments were isolated from a 1% agarose gel and purified using the Wizard Genomic DNA Purification Kit (Promega). In order to identify the specific edition ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... PCR products were isolated with a QIAquick Gel Extraction kit (Quiagen) and purified fragments cloned into pGEM-T Easy vector (Promega). Specific details for the generated probes are as follow (gene name (accession number) ...
-
bioRxiv - Cancer Biology 2022Quote: ... levels of Firefly and Renilla luminescence in cell lysates were measured by Synergy H1 microplate reader according to Promega’s Dual-Glo kit protocol (Promega #E2920). Fold changes of AP-1 activity were presented by the ratio of normalized Firefly/Renilla to control wells.
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extractions were carried out using the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, United States of America) following Lehner et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was eluted from the beads using the elution buffer (1% SDS and 100 mM NaHCO3) and purified by PCR purification kit (Promega). The final products were analyzed by quantitative real-time PCR with the primers listed below:
-
bioRxiv - Plant Biology 2022Quote: ... Samples representing different stages of the parasitizing process (i.e. root development) were extracted using the Maxwell® RSC Plant RNA kit (Promega) with the Maxwell® RSC Instrument (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... SpCas9 gRNAs were transcribed at 37 °C for 16 hours using the T7 RiboMAX Express Large Scale RNA Production Kit (Promega). For gRNAs utilized in in vitro cleavage reactions containing SpRY from human cell lysates ...
-
bioRxiv - Microbiology 2022Quote: ... Infected cells were incubated for approximately 18-20 hours and luciferase was measured using the Promega BrightGlo luciferase kit following manufacturers’ instructions (Promega). Entry signal was normalized to the average signal for the “no spike” control ...
-
bioRxiv - Microbiology 2022Quote: The total RNA of tissues was extracted using the Maxwell RSC simply RNA tissue kit (AS1340, Promega, Madison, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... HCT116 cell line was treated for 24 h with 10 µM curcumin and RNA was isolated using the Maxwell® 16 IVD system and the Maxwell Simply RNA Tissue Kit according to the manufacturer’s instructions (Promega). RNA was reverse transcribed using the SuperScript® VILO cDNA Synthesis Kit (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Cancer Biology 2022Quote: GSH/GSSG measurement was performed by a glutathione S-transferase (GST) enzyme coupled reaction using (GSH/GSSG Glo kit, Promega). Cells (2×104 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse DNA was extracted from the ear using the Wizard® Genomic DNA Purification Kit from Promega (Madison, WI, USA), as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Genomic DNA from T0 and T9 (IgA+, IgA- and unsorted) samples was extracted using the Wizard Genomic DNA Purification kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and reporter activation quantitated as the ratio of firefly luciferase (FFluc)/Renilla luciferase (Rluc) activity measured using the Dual-Glo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR amplified inserts were run on a 1% agarose gel and purified using the Wizard SV Gel and PCR Clean-Up System kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The total RNA (1-2 μg) was reverse transcribed with a GoScript™ Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated with the Maxwell RSC Viral Total Nucleic Acid Purification Kit on a Maxwell RSC 48 instrument (Promega). Isolated ZIKV RNA was titrated by qRT-PCR using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: Total plant RNA extraction and DNAse treatment were performed using the SV Total RNA Isolation Kit (Promega, Madison, WI, USA), followed by Reverse Transcription with SMART ® MMLV (Takara Bio USA ...
-
bioRxiv - Physiology 2020Quote: ... For the RNA sequencing samples the isopropanol phase of TRIzol extraction was transferred to Reliaprep tissue Miniprep kit (Promega, USA) columns to ensure high quality RNA samples were used ...
-
bioRxiv - Microbiology 2021Quote: ... Five ml of BHI broth containing 10 μg/ml tetracycline was inoculated with a single colony and genomic DNA was extracted (Wizard DNA extraction kit, Promega). Genomic DNA was sequenced by paired-end joining Illumina (Biomics Platform of the Institut Pasteur ...
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Luciferase activity was measured after 48 hours (with or without drug treatment) using Reporter Lysis Buffer kit (Promega, Madison, WI) per manufacturer’s instructions and a Synergy H4 plate reader.
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of bacterial culture was pelleted at 15,000 x g for 15 min at 4 °C then samples were prepared according to the directions for the Wizard HMW DNA Extraction kit for Gram-negative Bacteria (Promega). The University of Michigan Microbiome Core quantified the genomic DNA samples ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we extracted RNA from the whole body using a modified Trizol RNA extraction procedure with the Purelink RNA Purification Kit (Promega), followed by amplification of the product with the Ovation RNAseq System V2 (Tecan ...
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... Using the primers provided in Supplementary Table 3 we performed PCRs on 40 ng of genomic material extracted from wild type mosquitoes of the G3 strain using the Wizard Genomic DNA purification kit (Promega). The primers were modified to contain suitable Gibson assembly overhangs (underlined ...
-
bioRxiv - Genetics 2020Quote: ... They were grown to adulthood and their gDNA was individually extracted using either the Wizard Genomic DNA purification kit (Promega) or the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were harvested by trypsinization and RNA was isolated using Maxwell LEV simply RNA Cells/Tissue Kit (Promega, Madison, USA), according to the company’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Both human cell lines were validated using the cell line authentication service at Duke University and confirmed using the GenePrint 10 kit from Promega and tested to be mycoplasma-free ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were validated by DNA fingerprinting through the University of Colorado Molecular Biology Service Center utilizing the STR DNA Profiling PowerPlex-16 HS Kit (DC2101, Promega)(Table S4).
-
bioRxiv - Microbiology 2019Quote: ... synthesized by in vitro transcription of a NdeI-linearized pGEM-T plasmid containing the 135bp cDNA target fragment using the T7 RiboMAX in vitro transcription kit (Promega). Negative controls (without template RNA and RNA from mock-infected cells ...
-
bioRxiv - Immunology 2019Quote: ... Viral RNA was extracted from 300μL of plasma using the Viral Total Nucleic Acid Purification kit (Promega, Madison, WI, USA) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Plant Biology 2020Quote: ... The overlapping PCR products were separated and purified by the Spin Column PCR Product Purification Kit (Wizard SV Gel and PCR Clean-Up System) following manufacturer’s instruction (Promega, WI). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase digestion of cellular RNA was verified by purifying RNA from supernatant after immunoprecipitation using Reliaprep RNA purification kit (Promega) and then analyzing it by denaturing formaldehyde-agarose gel electrophoresis followed by imaging of the ethidium bromide stained gel.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2020Quote: ... were detected by the alteration of the dose-response curve measured using CellTiterGlo Chemoluminescent Kit (Promega Corporation, Cat. No.: G7573). Cell lines were confirmed to be mycoplasma-negative using the Mycoalert PLUS Mycoplasma detection kit (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... coli was grown in NB liquid medium (180 rpm, at 30 ° C) and had its DNA extracted with Wizard Genomic DNA Purification Kit (Promega). The number of bacteria in the seed and root was calculated based on the values of Ct (cycle threshold ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then excised and purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega, Madison, WI) according to manufacturer’s protocol ...