Labshake search
Citations for Promega :
7701 - 7750 of 8279 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Ghost Database KY21.Chr1.1715) we extracted genomic DNA from local Norwegian animals using the Wizard Genomic DNA Purification Kit (A1120, Promega). We then used the purified gDNA at a concentration of 100-150ng/μl ...
-
bioRxiv - Cell Biology 2023Quote: DNA was prepared from bacterial cultures grown at 37°C using a Midiprep kit (PureYield Plasmid Midiprep System, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 ng of total RNA was transcribed to cDNA using the ImProm-II™ reverse transcription kit (Promega, A3500) with random primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Renilla and Firefly luciferase activities were measured on a luminometer using the Promega dual luciferase kit (Promega, E1910) according to manufacturer’s instructions.
-
bioRxiv - Genetics 2023Quote: ... RNA (1000 ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript RT kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Genomics 2023Quote: ... Protein was precipitated by the addition of 200 μl Protein Precipitation Solution (Promega Wizard HMW DNA Extraction Kit A2920). Using a wide bore tip the samples were mixed by drawing up contents from the bottom of the tube and then expelled on the side of the tube 5 times ...
-
bioRxiv - Genomics 2023Quote: ... The total cellular DNAs of the activated CD4+ T cells were isolated using a DNA extraction kit (Promega Wizard) for analysis.
-
bioRxiv - Microbiology 2023Quote: ... Total genomic DNA was isolated from overnight cultures of Ag1 and Ag2 using the Genome Wizard kit (Promega, WI), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The sequence of the plasmid was verified by sequencing using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega). To generate a pDON-5 Neo-vector expressing IFNAR1 with the W70C mutation ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Caspase CP and CAEC apoptosis was determined after treatment with hemin or vehicle using a Caspase glo kit (Promega) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1-2 μg) was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Genomics 2023Quote: ... DNA of plant selected at this stage was extracted from rosette leaves using Wizard Genomic DNA Purification kit (Promega) and digested with methylation-sensitive restriction enzyme (MspI or CfoI ...
-
bioRxiv - Microbiology 2023Quote: ... UTI-59 DNA for long-read sequencing only was extracted using the Wizard HMW DNA Extraction Kit (Promega, USA) following the manufacturer’s instructions excepted eluted in molecular grade water ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from FFPE samples (Discovery Cohort) using Maxwell 16 LEV RNA FFPE Kit (Promega, Madrid, Spain), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and equal amounts of RNA per sample were transcribed into cDNA using the GoScriptTM Reverse Transcription Kit (Promega #A5000). Quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... tumoral area was macrodissected prior DNA extraction using Maxwell 16 FFPE LEV DNA Purification Kit (Promega, Madison, WI, USA). DNA from the 60 non-CCHD carotid bodies were previously extracted and passed internal quality control at the VHIO’s laboratory before sequencing ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Females from each progeny were then pooled to perform genomic DNA extraction (Wizard® Genomic DNA Purification Kit, Promega) and subsequently do amplicon sequencing on the dsx target to check the frequency of the dsxFΔ11 allele in the offspring ...
-
bioRxiv - Cell Biology 2024Quote: ... we isolated individual clones and screened for expression using the C-terminal nanoluc fusion (Nanoluc Lytic Detection Kit, Promega), followed by additional characterization of SMO agonist-induced ciliary accumulation via microscopy ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The plasmid DNA was purified from 4-mL overnight cultures by use of the Wizard Plus MiniPrep kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The linearized plasmid was then purified using the Wizard® SV gel and PCR clean-up system kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... Samples were prepared according to the directions from the Wizard HMW DNA Extraction kit for Gram-negative Bacteria (Promega).56 The genomic DNA was rehydrated in DNA Rehydration Solution and Illumina sequenced (SeqCoast) ...
-
bioRxiv - Microbiology 2024Quote: ... The sequences of all the plasmids were verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Physiology 2024Quote: Chymotrypsin-like 20S Proteasome activity was measured via a commercially available kit (Promega, Madison, WI, USA; Cat No. G8622) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Bacterial DNA of both wildtype and mutants were purified with a Wizard genomic DNA purification kit (Promega, Wisconsin, US). DNA was then tagged and multiplexed with the Nextera XT DNA kit (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... The ground material was used for genomic DNA extraction with the RSC Plant DNA Kit (Promega, Madison, WI, USA) using the Maxwell® RSC device according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: cDNA levels were measured by quantitative PCR using the GoTaq® qPCR kit (Promega Ref A6002, Madison, WI, USA) according to the manufacturer’s instructions under standard cycling conditions ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by gel purification of the products with a Wizard SV Gel and PCR Clean-Up System kit (Promega). Transcription products were separated on a 6% denaturing polyacrylamide gel (AccuGel 19:1 ...
-
bioRxiv - Immunology 2024Quote: ... DY401-05) and/or relative LDH levels (as a surrogate for pyroptosis) using a CytoTox 96 Kit (Promega; G1780).
-
bioRxiv - Biochemistry 2024Quote: ... Colonies were pooled with LB and samples were diluted to an OD600 of ∼4.0 and 1 mL of concentrated cells underwent genomic DNA preparation using the Wizard Genomic DNA Purification Kit (Promega). DNA was quantified using the QuantiFluor ONE dsDNA System (Promega) ...
-
bioRxiv - Biochemistry 2024Quote: ... Each library was diluted to an OD600 of ∼4.0 and 1 mL of concentrated cells underwent genomic DNA preparation using the Wizard Genomic DNA Purification Kit (Promega). DNA was quantified using the QuantiFluor ONE dsDNA System (Promega) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Firefly Luciferase and Renilla were measured on a Berthold Luminometer Centro LB960 using the Dual-Luciferase reporter kit (Promega). For siRNA- mediated knock-down ...
-
bioRxiv - Biophysics 2024Quote: ... Complementary DNAs were obtained with the SuperScript II Reverse Transcriptase kit (18064022, Thermofischer Scientific) and random hexamers (C1181, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Next the DIG-labeled RNA probes were synthesized by the transcription reaction using Riboprobe Systerm-T7 kit (Promega, P1440) and DIG labeled UTP (Roche ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... High-molecular-weight (HMW) DNA was extracted using the Wizard® HMW DNA Extraction Kit (Promega cat. no. A2920) according to the protocol for plant tissue with the following specifications/modifications ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... the aqueous phase was collected in EtOH and RNA lysis buffer from the SV Total RNA Isolation kit (Promega), and the manual instruction was followed ...
-
bioRxiv - Microbiology 2020Quote: ... cell supernatants were harvested for RNA extraction with a Maxwell RSV Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI). Then ...
-
bioRxiv - Biophysics 2021Quote: HEK293T cells were collected and pelleted 72 hr post-transfection for genomic DNA extraction using the Wizard Genomic DNA Purification Kit (Promega). The target locus was PCR-amplified using AccuPrime Pfx high-fidelity DNA polymerase (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting libraries were checked for their quality using the High-sensitivity DNA chip using the Agilent 2100 Bioanalyzer (Waldbroon, Germany) and quantified using the QuantiFluor One dsDNA kit (Promega). Paired-end (2x300bp ...
-
bioRxiv - Cell Biology 2020Quote: ... and individual colonies were inoculated in Luria-Bertani (LB) media for DNA extraction using DNA miniprep or midiprep kits (Promega). All mutations were verified by Sanger DNA sequencing (Stony Brook University Genomic Facility) ...
-
bioRxiv - Cell Biology 2020Quote: ... proteins were produced from pcDNA3-based plasmids at 30 °C for 90 min using the in vitro transcription & translation (IVTT) kit (Promega), following manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Pooled DNA extractions (minimum 90 adult mosquitoes or 3500 L1 larvae) were performed using the Wizard Genomic DNA Purification kit (Promega). A 349 bp locus containing the predicted on-target cleavage site was amplified with primers containing Illumina Nextera Transposase adapters (underlined) ...
-
bioRxiv - Developmental Biology 2021Quote: ... media was collected at a single timepoint (12 hours) and the Promega Glutamate/Glutamine-Glo kit (Promega cat. no. J8021) was used ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and from the interior tissue (at least 2 mm away from the outermost edge of the specimen) using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Overnight cultures were used for genomic DNA (gDNA) preparation using Promega Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) or Epicenter MasterPure Complete DNA and RNA Purification Kit (Lucigen ...
-
bioRxiv - Genetics 2022Quote: ... instrument was configured with the Standard Elution Volume (SEV) hardware and using the Maxwell 16 Cell DNA purification kit (Promega). For total RNA isolation ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then pelleted at 300g for 7 minutes and resuspended in 200μL of Homogenization Buffer from the Maxwell RSC simplyRNA Tissue Kit (Promega #AS1340). Cells were then lysed by adding 200μL of lysis buffer and transferred into the Maxwell RSC Cartridge ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mammalian expression vectors for EphA1 WT and EphA1 P460L were transfected into HEK cells using Fugene6 transfection kit (Promega). Expression of EphA1 WT or EphA1 P460L was confirmed by immunoblotting with anti-Flag or anti-Myc antibody.