Labshake search
Citations for Promega :
7651 - 7700 of 8279 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining was carried out with commercial kit (Promega, Madison, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were lysed after 72 h (2+1 DIV for differentiations) using the Dual Luciferase Reporter kit (Promega, E1960) and luciferase activity was measured using a Victor3 (Perkin Elmer ...
-
bioRxiv - Microbiology 2022Quote: ... for 1 h at 37 °C and cDNA was then synthesized using a Moloney murine leukemia virus (MMLV) reverse transcription kit with random primers following the manufactureŕs protocol (Promega). To check for the presence of remaining DNA ...
-
bioRxiv - Genomics 2020Quote: DNA was extracted from a single colony of each isolate with a Wizard® Genomic DNA Purification Kit (Promega), and the quantity and quality were determined with a Quantus Fluorometer (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was synthesized from 400 ng of RNA using ImProm-II Reverse Transcription system kit and random primers (Promega). Quantitative PCR was performed in technical duplicates using SensiMix SYBR mix (Bioline) ...
-
bioRxiv - Cell Biology 2021Quote: ... and a total amount of 2 μg RNA was reverse transcribed with a GO Script Reverse Transcriptase kit (Promega) using random primers ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA of all the strains was isolated using the Wizard genomic DNA purification kit (Promega, Madison, WI, USA), following manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: ... All reactions were performed as biological triplicates and technical duplicates using a GoTaq® qPCR Master Mix Kit (Promega). The primers were designed according to the ARG gene sequence (LinJ.35.1490 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and were frequently tested for absence of mycoplasma and cell lines were authenticated using STR profiling kit from Promega.
-
bioRxiv - Zoology 2020Quote: ... Other sections were digested in a mixture of 97% Nuclei Lysis Solution (Promega; from the Wizard DNA isolation kit) and 3% 20mg/ml Proteinase K (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: gDNA samples for library preparation were extracted from overnight LB cultures using the Wizard Genomic DNA Purification kit (Promega) as described above ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.5 ml (approximately 2 × 109 cells) were used for gDNA extraction with the Wizard Genomic DNA Purification kit (Promega), which typically yielded 50 μl of 0.5-1.5 μg/μl gDNA.
-
bioRxiv - Microbiology 2021Quote: ... Cell viability was determined 24 h after the addition of compound-containing DMEM using the CellTiter-Glo kit (Promega) and a luminescence plate reader (Perkin Elmer) ...
-
bioRxiv - Microbiology 2021Quote: ... Luciferase activity in cell lysates were measured by using either Firefly or Renilla luciferase kits (Promega, Madison WI, USA), and light emission was measured in arbitrary light units on a Glomax 20/20 Luminometer (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... ZmIBH1-1 was fused to HaloTag using the kit from pFN19K HaloTag T7 SP6 Flexi Vecto (cat#G184A) (Promega). ZmCLA4 fused to HaloTag was expressed using the TnT SP6 High-Yield Wheat Germ Protein Expression System (L3260 ...
-
bioRxiv - Cell Biology 2021Quote: ... Supersignal kit (Pierce) and a LAS-3000 imager (Fujifilm) or AP-coupled antibodies and NBT/BCIP as substrates (Promega). Rabbit polyclonal antibodies obtained and purified using full-length Arpin were previously described (Dang et al ...
-
bioRxiv - Immunology 2021Quote: ... and several sample types were evaluated for ADCC and ADCP functionalities using the corresponding Reporter Bioassay kit (Promega Corporation). ADCC and ADCP induction was expressed as induction ratio (IR) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were harvested 48 hours post-transfection and genomic DNA was extracted using the Wizard® SV Kit (Promega). Genomic targeting efficiency for each gRNA was determined through annealing and digestion with T7 Endonuclease I (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Relative cell viability was determined using a Cell counting kit-8 (Dojindo) and read on a microplate reader (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... 3βHSD and FSHR in the supernatant of cultured GCs were quantified using GoTaq® qPCR Master Mix Kit (Promega) as previously described [29] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA was extracted from clinical samples (300μl) via a Maxwell 48 device using the Maxwell RSC Viral TNA kit (Promega) with a viral inactivation step using Proteinase K ...
-
bioRxiv - Immunology 2020Quote: ... The identity of the Huh7 cells used in this study was verified by using the GenePrint STR kit (Promega) (DNA Analysis Facility ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was isolated from whole mount larvae or dissected tissue using the Maxwell RSC simplyRNA Tissue kit (Promega Corp. ...
-
bioRxiv - Genomics 2021Quote: ... We extracted the total RNA of the larval stage using ReliaPrep RNA Tissue Miniprep kit (Promega, Madison, WI/USA) according to the supplier’s recommended protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The identity of the Huh7 cells used in this study was verified by using the GenePrint STR kit (Promega) (DNA Analysis Facility ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from filter paper punches using the manufacturer’s protocol for Promega Maxwell DNA IQ Casework Sample kit (Promega) or Qiagen DNA Blood kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... lactate dehydrogenase (LDH) was measured from leukocyte supernatants using CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega; Cat. No. g1780) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... lactis CICC 6242 strain producing nisin A was extracted using a “Wizard Genomic DNA Purification” kit (Promega, Madison, USA). The nisA and nisRK genes were amplified through a polymerase chain reaction using the primers listed in Table 1 [29] ...
-
bioRxiv - Microbiology 2022Quote: The HEV replicon plasmids were linearised with BglII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: ... Sequences of all plasmids were verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Cat# 063001) with a Spectrum Compact CE System (Promega). The psPAX2-IN/HiBiT plasmid was a kind gift from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... RNA extraction was performed with the Maxwell RSC PureFood GMO and Authentication kit using a Maxwell RSC instrument (Promega France ...
-
bioRxiv - Microbiology 2022Quote: pSK-E2-nLuc replicon plasmid was linearised with BglII and pUC-HEV83-2 replicon plasmid was linearised with HindIII before being used to generate T7 in vitro transcribed RNA using the HiScribe T7 ARCA mRNA kit with tailing following manufacturer’s instructions (Promega). RNA was purified using an RNA clean and concentrate kit (Zymo Research ...
-
bioRxiv - Microbiology 2023Quote: The potential for M2e-specific antibodies to induce ADCC was evaluated using a mouse FcγRIV ADCC Reporter kit (Promega). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of cells was then processed using the Promega Wizard® genomic DNA preparation kit (Promega, WI, USA) to obtain genomic DNA ...
-
Throat colour polymorphism in relation to sex and body size of the Litter skink, Lankascincus fallaxbioRxiv - Zoology 2022Quote: ... black and white throat colored individuals using Promega Wizard® genomic DNA purification kit (Promega Corporation, Madison, Wisconsin, USA) following manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2024Quote: ... Viability of MV-4-11 cells was assessed using the CellTiterGlo 2.0 kit from Promega (as per manufacturer instructions); viability of HPAFII cells was assessed using PrestoBlue reagent from Thermo Fisher (as per manufacturer instructions) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were harvested by centrifugation and lysed with the Passive Lysis Buffer of the Dual-Luciferase detection kit (Promega). 10 µl cell extract was mixed with an equal volume of firefly luciferase assay substrate from the kit ...
-
bioRxiv - Cancer Biology 2024Quote: ... The identity of each cell line was confirmed by DNA fingerprinting via short tandem repeats at the time of mRNA and total protein lysate preparation using the PowerPlex 1.2 kit (Promega).
-
bioRxiv - Neuroscience 2024Quote: ... Blood and iPSC genomic DNA were extracted through Promega Wizard™ Genomic DNA Purification Kits (Promega, Madison, WI, USA). Array comparative genome hybridisation (array-CGH ...
-
Identification of echinacoside as a tobramycin potentiator against Pseudomonas aeruginosa aggregatesbioRxiv - Microbiology 2024Quote: Genomic DNA from different isolates was obtained from pelleted overnight cultures using the Wizard Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... DNA of plant selected at this stage was extracted from rosette leaves using Wizard Genomic DNA Purification kit (Promega) and digested with methylation-sensitive restriction enzyme (MspI or CfoI ...
-
bioRxiv - Plant Biology 2024Quote: ... The complete amount of RNA was reverse transcribed to cDNA using the oligodT from the GeneRacer kit and following the manufacture’s guide of ImProm-II Reverse Transcriptase (Promega). The PeSPL6 and PeSPL13a 5’-ends were amplified by PCR using the GoTaq Master mix (Promega) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All amplicons were then verified by gel electrophoresis and purified using a Wizard Gel Purification kit (Promega, Madison, WI).
-
bioRxiv - Microbiology 2023Quote: ... UTI-59 DNA for long-read sequencing only was extracted using the Wizard HMW DNA Extraction Kit (Promega, USA) following the manufacturer’s instructions excepted eluted in molecular grade water ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from FFPE samples (Discovery Cohort) using Maxwell 16 LEV RNA FFPE Kit (Promega, Madrid, Spain), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Caspase CP and CAEC apoptosis was determined after treatment with hemin or vehicle using a Caspase glo kit (Promega) according to manufacturer’s guidelines ...