Labshake search
Citations for PNA Bio :
201 - 231 of 231 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... Single-stranded PNA antidotes were ordered with HPLC purification from PNA Bio. CaCl2 solution and aPTT reagent were purchased from Trinity Biotech Plc ...
-
bioRxiv - Cancer Biology 2020Quote: ... following the IF protocol coverslips were denatured and hybridized TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio). Digital images were taken using Zeiss Axio Imager M1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... coverslips were hybridized with a TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio) to detect telomeric DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Coverslips were dehydrated in an ethanol series (70%, 90% and 100%) and hybridized at RT with a TRITC-OO[TTAGGG]3 labeled PNA probe (PNA Bio) in hybridization buffer (70% formamide ...
-
bioRxiv - Genomics 2020Quote: ... the same protocol was carried out using a centromere probe (CENPB-AF488, PNA Bio F3004).
-
bioRxiv - Genomics 2020Quote: ... and dehydrated in an ethanol series before co-denaturation of slide and PNA probes (TelG-Cy3 PNA Bio F1006, CENPB-AF488 PNA Bio F3004) for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2 ...
-
bioRxiv - Genomics 2020Quote: ... and dehydrated in an ethanol series before co-denaturation of slide and PNA probes (TelG-Cy3 PNA Bio F1006, CENPB-AF488 PNA Bio F3004) for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2 ...
-
bioRxiv - Genomics 2020Quote: ... Slides were co-denatured for 2 mins at 80°C with TelG-647 (PNA Bio F1014) in hybridization solution (10mM Tris-HCl pH 7.2 ...
-
bioRxiv - Bioengineering 2020Quote: Mutation rate for each guide was determined by laser-assisted cytoplasmic injection36 of in vitro fertilized embryos with 6pL of a solution containing 67ng/μL of in vitro transcribed gRNA alongside 133ng/μL of Cas9 mRNA or 167ng/μL of Cas9 protein (PNA Bio, Inc., Newbury Park, CA) incubated at room temperature for 30 minutes prior to injection ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 protein was ordered from PNA Bio (CP01-50, Thousand Oaks, CA) and used to check cutting efficiency of the guides in vitro ...
-
bioRxiv - Immunology 2020Quote: ... The sequence has been designed to have a melting temperature above 55°C (predicted with the PNA tool: https://www.pnabio.com/support/PNA_Tool.htm, from PNA Bio, Inc.) and orthogonal to the sequence of M13mp18 and validated using NCBI BLAST online tool38.
-
bioRxiv - Bioengineering 2020Quote: ... purified SpyCas9 protein 30 pmol (PNA Bio, #CP02 or 3xNLS-SpCas943(prepared by the Scot Wolfe laboratory ...
-
bioRxiv - Genetics 2020Quote: ... Zygotes were electroporated according to the ZEN2 protocol (93, 94) with a final concentration of 250ng/ul Cas9 mRNA (PNA Bio) and 300ng/ul sgRNA dissolved in TE pH7.5/Opti-MEM at a 1:1 ratio (93) ...
-
bioRxiv - Genetics 2020Quote: ... M4KO mice were generated by cytoplasmic microinjection of 25ng/ul Cas9 mRNA (PNA Bio) and 12.5ng/ul of each of four sgRNAs ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng/μl rCas9 protein (PNA Bio CP01-20 Thousand Oaks, California) and duplex buffer (IDT ...
-
bioRxiv - Molecular Biology 2020Quote: ... the coverslips were dehydrated and incubated with a telomeric G-strand PNA probe (AlexaFluor 488-TTAGGG3; PNA Bio) in hybridization buffer (10 mM Tris pH 7.4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cas9 (PNA Bio, CP01-50) ribonucleic particles (CRNPs ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cas9 protein was purchased from PNA Bio Inc ...
-
bioRxiv - Genomics 2020Quote: ... 1 μM mPNA (PNA BIO INC, USA) and DNase/RNase free distilled water (10977-049 ...
-
bioRxiv - Genomics 2020Quote: ... 1.25 μM cPNA (PNA BIO INC, USA), 1 μM mPNA (PNA BIO INC ...
-
bioRxiv - Neuroscience 2020Quote: ... along with sgRNA (80 ng/μL) and Cas9 protein (300 ng/μL; PNA Bio, CP01-200). A total of 1500 ORL embryos were injected at the Insect Transformation Facility at the University of Maryland Institute for BioScience & Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixture was prepared on ice containing 5 µM Cas9 (PNA Bio, CP02), 1 µg/µL sgRNA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... sgRNAs were mixed with purified Cas9 protein (PNA Bio #CP01) with a final injected concentration of 0.05% phenol red to visualize the injection mix ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cas9 (1 mg/ml; CP01-200, PNA Bio Inc) and fresh sgRNA (1 ug ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cas9 protein (PNA Bio #CP01), phenol red ...
-
bioRxiv - Genetics 2020Quote: ... An injection mix was made with 40 ng/ul sgRNA RNA and 300 ng/ul Cas9 protein (PNA Bio # CP01-50) and injected into embryos from our BDC stock (Fig ...
-
bioRxiv - Bioengineering 2020Quote: ... 150ng of Cas9 protein (PNA Bio, Inc., Newbury Park, CA), 1μL of 10X BSA ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction mixture was placed in the thermocycler for PCR settings prescribed by PNA Bio: 94° C for 3 minutes ...
-
bioRxiv - Immunology 2020Quote: ... Purified sgRNA (0.5 μg) was incubated with Cas9 protein (1 μg, PNA Bio, Newbury Park, CA, USA) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Telomere FISH was performed using Alexa 488 or Cy3-OO-TelC labeled PNA probes (PNA Bio Inc.). Streptavidin−Alexa 488 (Invitrogen #S32354 ...