Labshake search
Citations for PNA Bio :
51 - 100 of 201 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 1.25 µL of pPNA blocker (5 µM; chloroplast blockers; PNA Bio), 6.5 µL of PCR grade nuclease-free water (Qiagen) ...
-
bioRxiv - Biophysics 2023Quote: ... ribonucleoprotein (RNP) complexes included sgRNAs targeting either N- or C-terminal region (Integrated DNA Technologies - IDT) and Cas9 protein (PNA bio, Cat #CP01) were transfected together with linear dsDNA donors (IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... ribonucleoprotein complexes (PNA Bio) were generated at room temperature for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PNA probe against the MSH3-targeting antisense strand was ordered from PNA Bio (Thousand Oaks, CA, USA) with the sequence (5’-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... 1.25 µL of mPNA blocker (5 µM; mitochondria blockers; PNA Bio), 1.25 µL of pPNA blocker (5 µM ...
-
bioRxiv - Developmental Biology 2023Quote: Verification of in vitro cutting was confirmed by adding 250 ng of each sgRNA and 500 ng of Cas9 protein (PNA Bio cat. CP01-200) to 250 ng of PCR-amplified Cte-chd-l and incubating at RT for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... Centromeres were labeled with the pan-centromeric probe CENP-B-Cy5 (PNA Bio, F3005). After DNA FISH and CENP-B probe labeling ...
-
bioRxiv - Genetics 2023Quote: ... The Cas9 protein was purchased from PNA Bio (CP01). All homozygous animals edited by CRISPR/Cas9 were validated by Sanger sequencing ...
-
bioRxiv - Immunology 2023Quote: ... An injection mix containing 75 ng/μL of each gRNA and 250 ng/μL Cas9 protein (PNA Bio) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant Cas9 protein containing a nuclear localization signal (PNA Bio Inc) was reconstituted to a solution of 1 mg/mL Cas9 protein in 20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2,000 wild-type Liverpool strain Aedes aegypti embryos were injected with a mix containing recombinant Cas9 protein (PNA Bio, CP01) at 300 ng/µL ...
-
bioRxiv - Cell Biology 2022Quote: ... were generated at the BIDMC transgenic core using CRISPR/Cas9 with two site-specific guide RNAs (PNA Bio) per locus ...
-
bioRxiv - Cell Biology 2022Quote: ... 80 pg of sgRNA was co-injected with 200 pg of Cas9 protein (#CP01-50; PNA Bio, Newbury Park, CA) into 1-cell zebrafish embryos ...
-
bioRxiv - Cell Biology 2022Quote: ... Cas9 nickase (PNA Bio), and a single stranded DNA oligo (IDT ...
-
bioRxiv - Immunology 2022Quote: ... Slides were probed with 0.25 μM telomere probe (PNA Bio, F1002) for 1 hour at RT ...
-
bioRxiv - Molecular Biology 2022Quote: Selection and synthesis of Cas9 mRNA and sgRNA (5’ AAAATGTGAAATCTCTG-GACAGG-3’) to gp130 target region was provided by PNA Bio (Thousand Oaks, CA) and targeting efficiency of the sgRNAs used for the knock-in experiment was evaluated by surveyor nuclease assay to detect the sgRNA with highest DNA cleavage efficiency ...
-
bioRxiv - Immunology 2022Quote: ... Hybridization with 0.5 μg/mL CY-3 (CCCTAA)3 probe (PNA Bio) was carried out in hybridization buffer (10mM Tris pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... approximately 500 wild-type Aedes aegypti (Liverpool LVP-IB12 strain) embryos were injected with a mixture containing recombinant Cas9 protein (PNA Bio, CP01) at 300 ng/µl ...
-
bioRxiv - Neuroscience 2022Quote: ... Wild type embryos of the Aedes aegypti Liverpool strain were injected at the Insect Transformation Facility at the University of Maryland Institute for Bioscience and Biotechnology Research with a gene-targeting mixture composed of 300 ng/μL Cas9 protein with NLS (PNA Bio, CP01-200) and 4 sgRNAs ...
-
bioRxiv - Developmental Biology 2022Quote: ... In vitro transcribed guide RNAs were made from PCR-generated templates (Bhattacharya et al. 2015) and were complexed with Cas9 protein (CP01; PNA Bio) at 37°C before injection into the animal pole of fertilised eggs at the 1-2 cell stage ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA (200 ng/µL) was co-microinjected with Cas9 protein (600 ng/µL; PNA Bio) into embryos at the one-cell stage ...
-
bioRxiv - Developmental Biology 2022Quote: Injection mix containing Cas9 protein (PNA Bio; 100 ng/μl final concentration), sgRNA (80 ng/μL final concentration) ...
-
bioRxiv - Genetics 2022Quote: ... 750ng Cas9 protein (PNA Bio) and 375ng integration site gRNA were mixed ...
-
bioRxiv - Neuroscience 2022Quote: ... USA) and 1μl recombinant Cas9 protein (1 μg/μl, PNA Bio, Thousand Oaks, CA, USA) and 2μl RNAse-free water ...
-
bioRxiv - Developmental Biology 2022Quote: ... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
Activity regulates a cell type-specific mitochondrial phenotype in zebrafish lateral line hair cellsbioRxiv - Cell Biology 2022Quote: ... Both guides were mixed with Cas9 protein (PNA Bio, Newbury Park, CA, USA) and simultaneously injected into embryos at the single-cell stage ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... It includes the Recombinant Cas9 protein with NLS sequence (1500 ng /μl−1; PNA Bio, CP0120) and the sgRNA (750 ng/ μl−1) ...
-
bioRxiv - Bioengineering 2022Quote: ... The PNA-Maleimide was procured by PNA Bio. The Gold sensor chips for SPR experiments were obtained from Nicoya Lifesciences (cat ...
-
bioRxiv - Developmental Biology 2022Quote: Each injection mix contained 250 ng/µl total of the purified gRNAs and 500 ng/µl of recombinant Cas9 protein (PNA Bio) with 0.2% phenol red in nuclease-free water ...
-
bioRxiv - Developmental Biology 2022Quote: ... 250 ng/μl rCas9 (PNA Bio), and 50 ng/μl HDR templates were injected into one-cell stage embryos ...
-
bioRxiv - Genetics 2022Quote: ... and the capillary was injected with an injection mixture containing sgRNA (500 ng/ul) and Cas9 protein (CP-01, PNA Bio; 500 ng/ul) (injection pressure Pi 100 Pa ...
-
bioRxiv - Neuroscience 2022Quote: ... embryos at the very early 1 cell stage were injected with 374.5 ng/μl of the guide RNA targeted to zebrafish klc4 complexed with 800 ng/μl of Cas9 protein with NLS (PNA Bio). Injection volume was approximately 1nL ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated with PNA probes (each 1:1000) TelC-Cy3 (PNA Bio, Cat# F1002) or TelC-AlexaFlour-647 (PNA Bio ...
-
bioRxiv - Cancer Biology 2022Quote: ... or TelC-AlexaFlour-647 (PNA Bio, #F1013) in hybridizing solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9 protein (PNA Bio CP02) at 50ng/µL ...
-
bioRxiv - Cancer Biology 2022Quote: ... Centromere (PNA Bio, CENPB-AF488 or −647), telomere (PNA ...
-
bioRxiv - Genomics 2022Quote: ... The ready to use 5’-Cy3-labeled single strand telomeric probes (TTAGGG)7 (PNA Bio) were purchased from PNAGENE Inc (Daejeon ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR reactions for plant samples were supplemented with a custom peptide nucleic acid (PNA) blocker (ITS1PNABlk: 50-O-E–E-GTCGTGTGGATTAAA-30; PNA BIO INC, Thousand Oaks, CA) to block host plant ITS sequences ...
-
bioRxiv - Developmental Biology 2022Quote: ... and CAS9 protein (500 ng/µL, PNA Bio) in HEPES buffer pH 7.5 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Each slide was then covered with hybridising solution containing Cy3-O-O-(CCCTAA)3 probe (PNA bio) in 70% formamide ...
-
bioRxiv - Developmental Biology 2022Quote: ... Telomere staining was done using a TelC-Cy3 probe (PNA Bio) following a previously described method (97) ...
-
bioRxiv - Genetics 2022Quote: ... Cas9-NLS protein (PNA Bio) was added to the gRNA and incubated at room temperature for 5 min ...
-
bioRxiv - Genetics 2022Quote: Wild type embryos were injected with 300 ng/ul Cas9 protein (PNA Bio), 500 ng/ul pBac[3xP3-EGFP;Tc’hsp5’-Gal4Delta-3’UTR] (Addgene #86449) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then subjected to FISH using a peptide nucleic acid (PNA) probe specific to the telomeric sequence (CCCTAA)3 (TelC-Cy3, PNA BIO). Cells were dehydrated successively in 70% ...
-
bioRxiv - Developmental Biology 2021Quote: Mutants were generated by injecting one-cell stage embryos with 200 ng/ml sgRNAs and 500 ng/ml Cas9 protein (PNA Bio) using standard procedures (Shah et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... mutations we used CRISPR/Cas9 mutagenesis by injecting 1-cell stage embryos with 200 ng/μl T7 sgRNA and 500 ng/μl Cas9 protein (PNA Bio) as described (Shah et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... or with 5 nl or 10 nl of 75pg/nl of sgRNA mixed with 0.2 ng/nl of Cas9 protein (PNA Bio) and 0.1% Texas Red Dextran in 1 cell of 2-cell stage embryos ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (900 ng μl−1; PNA Bio, #CP01-20) was co-injected with both sgRNAs (20μM each ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant Cas9 protein (PNA Bio) and sgRNAs were injected at concentrations of 400 ng/µl of Cas9 protein and 100 ng/µl for each sgRNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... dsDNA or ssDNA PCR donors (final concentration 5-10 pg/nL) Cas9 protein tagged with a nuclear localization sequence (PNA Bio CP-01) (final concentration 300-500 pg/nL) ...