Labshake search
Citations for PNA Bio :
1 - 50 of 231 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 1200 ng gRNA were mixed with 2400 ng Cas9 protein with NLS (PNA Bio) in 5 μl nuclease-free water and incubated for 10 minutes at room temperature to form ribonucleoprotein (RNP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl of injection mixture consist of 1 µg of recombinant nls-Cas9 (PNA Bio), 200 ng of purified sgRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA1 and 50ng/μL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of zygotes positive for 3’ LoxP site ...
-
bioRxiv - Neuroscience 2024Quote: ... 25ng/μL gRNA2 and 50ng/uL SpCas9 protein (PNA Bio) was microinjected into the pronucleus of C57BL/6 zygotes ...
-
bioRxiv - Developmental Biology 2024Quote: ... co-injected one-cell stage embryos with RNPs containing 25 pg of gRNA and 500 pg of NLS-Cas9 protein (PNA Bio, Thousand Oaks, CA USA), and raised these fish to adulthood ...
-
bioRxiv - Cancer Biology 2024Quote: ... The telomere PNA probe (TelC) was purchased from PNA Bio (F1004). Images were collected by using an Axio Observer.Z1/7 (Zeiss Microimaging GmbH ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.19uL of 100uM chloroplast PNA (GGCTCAACCCTGGACAG; PNA Bio, Thousand Oaks ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.19uL of 100uM mitochondrial PNA (GGCAAGTGTTCTTCGGA; PNA Bio, Thousand Oaks ...
-
bioRxiv - Microbiology 2024Quote: ... For root samples mPNA/pPNA clamps (PNA BIO, Newbury Park, CA, USA) were used to inhibit the amplification of organelle DNA with the 16S rRNA gene primers (Supplementary Table 2) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 100 ng of which was used in cleavage assays with 300 ng of recombinant Cas9 (PNA BIO, Thousand Oaks, CA) and 100 ng of each guide RNA upon incubation at 37°C for 1 hour (Supplementary Fig ...
-
bioRxiv - Neuroscience 2024Quote: ... 25-30 ng/µL sgRNA was gently mixed with 0.5 ug/µL Cas9 (PNA BIO cat# CP01), and 0.5 µl 0.25% phenol red solution and diluted with RNase-free water to a final volume of 4 µL ...
-
bioRxiv - Genetics 2024Quote: Genome editing was performed by injecting nuclear-localized Cas9 (PNA Bio) preincubated at 37°C for 10 min with either a single-guide RNA (sgRNA ...
-
bioRxiv - Genomics 2024Quote: ... Purified Cas9 protein conjugated with a nuclear localization signal (NLS) was obtained commercially (PNA Bio). Microinjection mixes contained end-concentrations of 360 ng/µl Cas9 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cas9 recombinant protein with nuclear localization signal (260 ng/μl; PNA Bio, USA) was co-injected with the gRNA (140ng/µl ...
-
bioRxiv - Cell Biology 2024Quote: ... pH 7.2) containing Alexa 647-OO-(TTAGGG)3 PNA probe (PNA Bio, Newbury Park, CA) was added to each coverslip ...
-
bioRxiv - Cell Biology 2024Quote: ... and 10 mM Tris-HCl pH 7.2) containing a Cy3-OO-(TTAGGG)3 PNA probe (PNA Bio, Newbury Park, CA) and denatured at 80°C for 10 min on a heat block ...
-
bioRxiv - Genomics 2024Quote: ... and purified Cas9 protein (PNA Bio) were obtained commercially ...
-
bioRxiv - Bioengineering 2024Quote: ... developed in a peptide nucleic acid (PNA) format by PNA Bio Inc ...
-
bioRxiv - Developmental Biology 2024Quote: ... a mix of Synthego synthetized sgRNAs (final 250 ng/ul each) plus recombinant Cas9 protein (0.5ug/ul, PNA Bio) were injected using aluminosilicate glass needles (Sutter) ...
-
bioRxiv - Molecular Biology 2024Quote: ... or TelG-Cy3 PNA telomere probe together with a CENPB-Cy3 centromere probe (PNA Bio Inc). Slides were counterstained with DAPI (Electron Microscopy Sci. ...
-
bioRxiv - Molecular Biology 2024Quote: ... CO-FISH was performed as described [27] using a TelC-Alexa488-conjugate probe (PNA Bio, F1004) followed by a TelG-Cy3-conjugated probe (PNA Bio ...
-
bioRxiv - Microbiology 2024Quote: ... 0.285 uL of 100uM mitochondrial PNA (GGCAAGTGTTCTTCGGA; PNA Bio, Thousand Oaks ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The sgRNA mix and Cas9 endonuclease (PNA Bio, PC15111, Thousand Oaks, CA, USA) were co-injected into fertilized eggs at concentrations of 500 ng/µl and 1000 ng/µl ...
-
bioRxiv - Molecular Biology 2024Quote: One-cell embryos from C57BL/6J mice were injected with a mixture of 40 ng/µl of Cas9 protein (PNA Bio) and 25 ng/µl of each of the two sgRNAs complementary to the 3’ portion of Rif1-In31 (sgRNA1 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.285 uL of 100uM chloroplast PNA (GGCTCAACCCTGGACAG; PNA Bio, Thousand Oaks ...
-
bioRxiv - Microbiology 2024Quote: ... 5µg of Cas9 protein (PNA Bio) and 2.5µg of each of the sgRNAs were incubated together for at least 10 minutes at room temperature before nucleofection of iPSC cells occurred using a Human Stem Cell Nucleofector Kit 2 (Lonza) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Slides were first hybridised in a dark hybridisation chamber for 2 hours at room temperature with the forward CENP-B probe (PNA Bio, #3004), washed for 30 seconds in Wash Buffer #1 (10mM Tris-HCl (pH=7.4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and incubated for 2 hours with the reverse CENPB probe (PNA Bio, #F3009). Slides were then washed twice in Wash Buffer #1 for 15 minutes each with gentle rocking ...
-
bioRxiv - Neuroscience 2024Quote: ... One-cell C57BL/6J or App-KI fertilized embryos were microinjected with 50 ng/μl App C-terminus targeting guide-RNA and 40 ng/μl Cas9 protein (PNA Bio, Newbury Park, California). Injected embryos were transplanted into pseudo-pregnant B6D2 F1 females ...
-
bioRxiv - Neuroscience 2024Quote: ... and this RNA Duplex mix was combined with 1 μg/μL Cas9-NLS protein (PNA Bio). 1 nL of RNA guide-CAS9 mixture was injected into single cell stage TLF wildtype embryos ...
-
bioRxiv - Bioengineering 2024Quote: ... pH 8.8) and 2 μl of 5 μM PNA probe (∼10 pmol/ 150 ul of sample, PNA bio) were added ...
-
bioRxiv - Immunology 2024Quote: ... 250 µg/ml of Cas9 protein with an NLS resuspended in sterile water (PNA Bio, CP01), and 0.25% phenol red into 1-4 cell stage naturally spawned embryos.
-
bioRxiv - Bioengineering 2024Quote: ... 40 ng/uL of each sgRNA was mixed with Cas9 protein (PNA Bio) in mass ratio of 1:2 and incubated on ice for 10 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... were mated with B6D2F1 males and zygotes were collected from the oviducts at embryonic day 0.5 and incubated with SpCas9 protein (250ng/µl; PNA Bio, CA, USA), Cbln2-crRNA (5pmol/µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by a TelG-Cy3-conjugated probe (PNA Bio, F1006). Images were captured using a Zeiss Spinning Disk confocal microscope and t-SCE events were scored double-blinded ...
-
bioRxiv - Neuroscience 2024Quote: ... Targeting of the construct to the Rosa26 locus was performed in FVB fertilized zygotes via pronuclear co-injection with a mixture of 50 ng/µl Cas9 protein (PNA BIO Inc #CP01), sgRosa26-1 RNA (10 ng/µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50pg of each gRNA (Table S1) was co-injected with 1ng purified Cas9 protein (PNA Bio, CP01) into EGFP;MYCN;tp53-/- embryos at the one-cell stage ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mg/mL Cas9 protein (PNA Bio CP02), a gRNA targeting tyr (GGACTGGAGGACTTCTGGGG ...
-
bioRxiv - Neuroscience 2024Quote: ... sgRNA (110 ng/μL) and Cas9 protein (300 ng/μL; PNA Bio, CP01-200) at the Insect Transformation Facility ...
-
bioRxiv - Genetics 2024Quote: ... Injection mixes were prepared by mixing 1uL of 50uM duplex together with 1uL Cas9 protein (5mg/mL) obtained from PNA Bio and 1uL phenol red ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μl Cas9 protein (1μg/uL, PNA BIO), 2μL 0.5% phenol red and 2μL dH2O were incubated at room temperature for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Cas9 protein was purchased from PNA Bio, Inc ...
-
bioRxiv - Bioengineering 2024Quote: ... The peptide nucleic acid hybridization assay was performed in a method adapted from Godinho et al.16 Cy3-labeled peptide nucleic acid probes complementary to the luciferase antisense siRNA strand were purchased from PNA Bio. 5 μL of whole blood from each sample was homogenized in 300 μL homogenization buffer (QuantiGene Homogenizing Solution ...
-
bioRxiv - Cell Biology 2024Quote: ... The rest of the FISH procedure was performed according to the PNA FISH manufacture protocol (PNA Bio). The slides were air-dried briefly before being applied with the Prolong Gold Antifade Mountant medium (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Cas9 protein was purchased from PNA Bio (#CP01). All repair templates and crRNA sequences used in this study are listed in Supplementary Table S3.
-
bioRxiv - Cell Biology 2024Quote: ... and 100%) and hybridized at room temperature with a Cy-3 labelled Tel G (TTAGGG)n probe (PNA Bio) in hybridization buffer (70% formamide ...
-
bioRxiv - Cell Biology 2024Quote: ... Following hybridization with an AlexaFluor 564-TelC (TAACCC) PNA probe (PNA Bio) and DNA counterstain (DAPI ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1:300 dilution of PNA TelC-AF488 probe (PNA Bio #F1004)) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1:200 dilution of PNA TelC-AF488 probe (PNA Bio #F1004)) for 10 min at 80°C followed by 2 hour incubation at RT in dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... and centromeric PNA probes (PNA Bio) at 4 degrees in a hybridization chamber ...