Labshake search
Citations for Roche :
451 - 500 of 3681 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... GUN1 protein was expressed in RTS ProteoMaster (Roche). Full-length GUN1 cDNA and N-terminal truncated versions as EcoRI-SalI PCR fragments were ligated into pET48b (Novagen ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-HA (rt, 1:1000, Roche, clone 3F10), anti-CNG channel (ms ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was run on Lightcycler 480 (Roche) using SYBR Green 1 Master Kit (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... or RevertAid RT (Thermo) with random hexamers (Roche). qPCR was performed with the SensiFAST No-ROX Probe Master Mix (Bioline ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR experiments were performed with primers designed via the Primer-BLAST tool on the NCBI website and SYBR-Green (Roche, Cat#: 04707516001) in a Roche LightCycler 480 Instrument II to quantify the results ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were blocked in blocking solution (Roche DIG wash and block buffer set) diluted in 1x maleic acid for 1h at RT and riboprobes were detected by incubating in anti-digoxigenin-AP antibody (1:2000 in 1% sheep serum ...
-
bioRxiv - Microbiology 2021Quote: ... Temperature cycling conditions were set on a LightCycler® 480 Instrument II (Roche), using the following parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR reactions were set up using FastStart Essential DNA Green Master (Roche, #06402712001) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2022Quote: ... Transcription reactions were set up to label probes with digoxigenin (DIG, # 11277073910, Roche) and incubated at 37°C for two hours ...
-
bioRxiv - Biochemistry 2023Quote: ... The blot was then developed with DIG wash and block buffer set (Roche) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primers (Oligomer) and probes (Oligomer and Roche Applied Sciences) were ...
-
bioRxiv - Biochemistry 2020Quote: ... Details of primers and Universal Probe Library probes (Roche) and primers used can be found in Table S1.
-
bioRxiv - Biochemistry 2020Quote: ... Details of primers and Universal Probe Library probes (Roche) can be found in Table S1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with primer-appropriate Universal ProbeLibrary probes (Roche, Basel, Switzerland) and the ABI 7500 FAST qPCR system (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... using gene-specific primers and KAPA SYBR (KAPA Biosystems), on a Bio-Rad CFX96 real-time PCR machine ...
-
bioRxiv - Plant Biology 2021Quote: ... Primers were designed using the Universal Probe Library (Roche, https://lifescience.roche.com/en_de/brands/universal-probe-library.html#assay-design-center ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers were designed using Universal Probe library from Roche Diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... Complementary DNA (cDNA) was synthesized using random primers (Roche) and the High-Capacity cDNA Reverse Transcription kit (Life Technologies) ...
-
bioRxiv - Bioengineering 2024Quote: ... and primers (Table SE4) in a LightCycler 96 (Roche). Melt curves were used to confirm a single amplification product and the LightCycler 96 Application Software (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tissue slides were steamed for 32 minutes in Cell Conditioning 1 (CC1) solution (Roche Diagnostics, Cat. No. 950-500) for antigen retrieval ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene–specific primers (primer No.9–14) and a KAPA Biosystems kit (Roche, KAPA HiFi HotStart). The PCR conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RT-qPCR was performed after addition of SybrGreen (Roche). Expression relative to a normalization gene was calculated from Ct values according to the efficiency and delta delta Ct method ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR were performed using Light Cycler 480 (Roche) with the Light Cycler 480 SYBR Green I Master Kit (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR was performed with a LightCycler480 II (Roche). Relative gene expression was determined with the comparative CT method ...
-
bioRxiv - Cell Biology 2022Quote: ... and RT-qPCR analysis was performed using SybrGreen (Roche) to detect PIP4K2B expression ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-qPCR was run on a Lightcycler 480 (Roche) and Ct values obtained using the second derivative ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) as described before 4.
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed on a Lightcycler 96 (Roche). The following Taqman probes (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RTqPCR kit (BioRad ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on a LightCycler 480 (Roche) with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RTqPCR kit (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-qPCR was run on a LightCycler 480 (Roche) and Ct values obtained using the second derivative ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR experiments were done using LightCycler LC480 (Roche). All reactions were made in quadruplicate for samples originated from at least three distinct litters.
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed in a LightCycler 480 (Roche) with PerfeCTa SYBR Green Supermix (Quantabio) ...
-
FTSH3 facilitates complex I degradation through a direct interaction with the complex I subunit PSSTbioRxiv - Plant Biology 2023Quote: ... RT-qPCR was carried out in LightCycler 480 (Roche) using SYBR Green master mix (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... RT - qPCR was performed on the LightCycler 480 (Roche) using the TaqMan FAST Universal Mastermix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR experiments were performed in a lightcycler (ROCHE) device ...
-
bioRxiv - Developmental Biology 2024Quote: ... and developed at RT in BM Purple (Roche 11442074001). Reactions were stopped with PBS and fixed with 4% PFA overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by hybridization capture using a custom-designed SeqCap Target Enrichment probe set (Roche) targeting coding and canonical splice regions (+/-2 bp ...
-
Interdependent Iron and Phosphorus Availability Controls Photosynthesis Through Retrograde SignalingbioRxiv - Plant Biology 2021Quote: ... we used adapters from the KAPA Biosystems Single-Indexed Adapter Set A+B (Roche). Before pooling the libraries ...