Labshake search
Citations for Roche :
451 - 500 of 1110 citations for Rnase 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The DNA was then purified, treated with RNase H (ThermoFischer, 18021071) and Proteinase K (PCR grade, Roche, 3115836001) and concentrated with the DNA Clean & Concentrator-5 kit (Zymo ...
-
bioRxiv - Neuroscience 2022Quote: ... Supernatants were removed and pellets were resuspended in 2% BSA/PBS containing RNase inhibitor (0.2 U/μL, Roche). To enrich astrocyte nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM EDTA) with the addition of 0.5% SDS and 200 μg/ml of RNase A (Roche, 10109169001). The samples were heated at 37 °C for 60 min ...
-
bioRxiv - Immunology 2023Quote: ... Input DNA was obtained following the sample phenol-chloroform purification steps post overnight de-crosslinking of 10 μg of sonicated sample at 65 °C in the presence of 0.2 M NaCl and 10 μg/μl of RNase A and 0.8 μg/μl of Proteinase K (Roche). DNA was quantified with the Qubit dsDNA HS Assay Kit (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: Human embryo sorted cells were collected in Eppendorf containing 6µl of PBS supplemented with 0.5µl of Protector RNAse inhibitor (Roche, 3335399001) and conserved in −80°C ...
-
bioRxiv - Cell Biology 2023Quote: ... tissue culture-treated plate as described above and 50 μg/ml RNase (Cat#109142, Roche CustomBiotech, Indianapolis, IN) or 50 μg/ml DNase (04536282001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nucleic acid pellet was resuspended TE buffer and treated with 0.05 µg/µL RNase (Roche Cat# 11119915001) for >15 hr at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant containing chromatin fragments was then treated with 6-10 µg/g cells DNase-free RNase (Roche) at 37°C for 30 minutes and subsequently cleared by centrifugation at 30,000 rcf for 30 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 7.4, 150 mM NaCl, 1.25 mM MgCl2, 5 U/ml RNase inhibitor [Invitrogen], protease inhibitor cocktail [Complete; Roche] ...
-
bioRxiv - Immunology 2024Quote: ... nuclei were resuspended in 1mL ST buffer (nuclear flow cytometry, RNAseq experiment 2) or PBS/1% BSA/0.2UμL Protector RNAse inhibitor (Roche) (RNAseq experiment 1) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Biochemistry 2020Quote: ... and the presence of enzymes were confirmed by immunoblot using the anti-His6 antibody conjugated to peroxidase (BMG–His-1 monoclonal antibody) (Roche, Mannheim, Germany).
-
bioRxiv - Biophysics 2022Quote: ... and mixed with 1 mL Ni Sepharose 6Fast Flow (Cytiva, Tokyo Japan) (MinD) or cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland) (MinE and msfGFP-MinC) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The quenched PFA solution was then removed and the tissue was resuspended in ice-cold Hi-C Lysis Buffer (10mM pH=8 Tris-HCl, 10mM NaCl, 0.2% NP-40 and 1x Roche Complete protease inhibitor). The lysis was helped with a Dounce Homogenizer Pestle A on ice (series of 10 strokes in 10’ intervals) ...
-
bioRxiv - Biochemistry 2023Quote: ... The soluble fraction of the cell lysate was transferred to a tube containing 30 μL cOMPLETE His-Tag purification Ni-NTA resin (Roche, Basel, Switzerland) suspended in 500 μL buffer A (8 M urea ...
-
bioRxiv - Immunology 2019Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The A20 cells were grown in RPMI-1640 (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 60 U/mL human IL-2 (Proleukin, Roche Diagnostics). The F9 teratocarcinoma cells were grown in DMEM (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Cell Biology 2021Quote: ... human NEMO (5 µg) and ATP (2 mM) (Roche, 10519979000) were incubated at 37°C for the indicated time in a buffer containing 150 mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... coated with 5 µg/ml human plasma fibronectin (Roche, 11080938001) in growth medium overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... and human Ki67 rabbit monoclonal antibody (Roche Diagnostics, 790-4286). Images were captured with VENTANA iScan HT (Roche Diagnostics ...
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.01 mg/mL of human insulin (Roche, Indianapolis, IN, USA), 10 mM HEPES (Corning ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... The lysis buffer was supplemented either with 40 U/ml RNase inhibitor (Molox) or 50 U/ml Benzonase (Roche) to differentiate between RNA- and protein-dependent interactions ...
-
bioRxiv - Genomics 2020Quote: ... the pellets were washed with ice-cold nuclei suspension buffer (1X PBS containing 2% BSA and 0.2 U/µl Protector RNase Inhibitor, ROCHE) and filtered through a 30μm cell strainer (Fisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... 2.5 µl of cDNA in RNase free water was made up to 25 µl with FastStart Universal SYBR Green Master (ROX, 12.5 µl, Roche), Ultra Pure Water (8 µl ...
-
bioRxiv - Microbiology 2019Quote: ... The solution was then supplemented with 20 mM MgSO4 and treated with 50 μg mL-1 RNase A (Roche) and 10 μg mL-1 DNase (Sigma-Aldrich ...