Labshake search
Citations for Roche :
4701 - 4750 of 5245 citations for Human Cholecystokinin 12 CCK12 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... Libraries were prepared by the Genome Technologies core facility at The Jackson Laboratory using the KAPA mRNA HyperPrep Kit (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... NGS sequencing adapter addition and multiplex indexing of DNA samples was achieved using the KAPA Hyper Prep Kit (KAPA Biosystems KK8502) according to manufacturer instructions ...
-
bioRxiv - Genetics 2019Quote: ... Real-time PCR was performed in a final volume of 20 µl containing 20 ng of cDNA using SYBR Fast Universal qPCR Kit (Kapa Biosystems) and analyzed using the Quant Studio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Genomics 2021Quote: ... 250 ng of genomic DNA was sheared and libraries were prepared using the KAPA HyperPrep Kit (Kapa Biosystems, Wilmington, MA, USA). For each RNA sample ...
-
bioRxiv - Genomics 2020Quote: ... Synthesis of cDNA was performed with 150 ng of total RNA using the First Strand cDNA Synthesis kit (Roche Applied Science) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were quantified by qPCR using the Library Quantification Kit for Illumina sequencing platforms (cat#: KK4824, KAPA Biosystems, Boston, MA, USA), using 7900HT Real Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genomics 2020Quote: ... a total of 1.0 μg of extracted DNA was used as the starting material for PCR-free library construction (KAPA HyperPrep PCR-Free Library Prep kit; Roche, #KK8505); libraries were then mechanically sheared (Covaris microtube system ...
-
bioRxiv - Genomics 2020Quote: ... the concentration of ligated fragments in each library was quantified (KAPA Library Quantification Kits for Illumina platforms; Roche/KAPA Biosystems, # KK4824). Libraries with concentrations of more than 3 nM and fragments with peak size 400 bp were sequenced on an Illumina Novaseq 6000 S4 and/or S2 Flow Cell (FC) ...
-
bioRxiv - Genomics 2020Quote: ... the concentration of ligated fragments in each library was quantified (KAPA Library Quantification Kits for Illumina platforms; Roche/KAPA Biosystems, # KK4824). Libraries with concentrations of more than 3 nM and fragments with peak size 400 bp were sequenced on an Illumina Novaseq 6000 S4 and/or S2 Flow Cell (FC) ...
-
bioRxiv - Genomics 2021Quote: ... 30μL from each was plated and diluted to 10ng/μL using 10mM Tris-HCl and sequencing libraries were prepared in triplicate using a miniaturized version of the KAPA HyperPlus kit (Roche, KK8514) with Illumina-compatible KAPA Unique Dual-Indexed Adapters (Roche ...
-
bioRxiv - Immunology 2022Quote: ... A total amount of 200ng RNA per sample was used for the preparation of RNA sequencing libraries using the KAPA RNA HyperPrep Kit with RiboErase (HMR) (KAPA Biosystems). In short ...
-
bioRxiv - Microbiology 2022Quote: Ten nanograms of cDNA were used as a template in a 5 μl reaction mixture from a KAPA SYBR FAST qPCR kit (Kapa Biosystems). Primers used are listed in Table S2 ...
-
bioRxiv - Immunology 2022Quote: ... and a primer complementary to the template-switch adapter (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAAGCAGTGGTATCAACGCAG, adapter in italic) with the KAPA Real-Time Library Amplification Kit (Kapa Biosystems). Adapters were required for subsequent sequencing reactions ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems) prior to cluster generation.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio) and a LightCycle®96 (Roche) real-time PCR detection system ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Cerebellar specimen gained from 4-weeks old Prpf8Y2334N mice were processed using KAPA RNA Hyperprep Kit with RiboErase (Kapa Biosystems/Roche) due to discontinuation of the Lexogen library construction kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified by fluorometry on a Qubit instrument (LifeTechnologies, Carlsbad, CA) and by qPCR with a Kapa Library Quant kit (Kapa Biosystems-Roche) prior to sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We prepared the WGBS libraries according to MethylC protocol (Urich et al., 2015) and quantified them using a combination of KAPA Library Quantification kits (Kapa Biosystems) and an Agilent High Sensitivity DNA kit (Agilent Genomic) ...
-
bioRxiv - Physiology 2022Quote: ... 250 ng of total RNA was used to prepare barcoded RNA-seq libraries using Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems). Samples were sequenced on the HiSeq 2500 (Figure 2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library quality control was performed with an Agilent 2100 Bioanalyzer and quantity determined via the KAPA Library Quantification Kit (KAPA Biosystems).
-
bioRxiv - Bioengineering 2022Quote: The open-reading frame of the nikABCDE gene was amplified from genomic DNA belonging to Escherichia coli BL21(DE3) using the KAPA-HiFi Master Mix kit according to the manufacturer’s instructions (Kapa Biosystems, #KK2601). Primers are found in Supplementary Table 3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... We next amplified full-length 1.7kb NT5C2 DNA insert by PCR using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, #KK2601) and the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time PCR was carried out with the Light Cycler Fast Start DNA Master SYBR Green Kit (Roche Applied Science, Germany) using LightCycler (Roche Applied Science ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA from twenty-four females from each of the four groups was extracted using Roche High Pure™ PCR Template Preparation Kits (Roche Molecular Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... Bulk RNA-seq libraries were prepared from 500 ng of total RNA for each sample using KAPA mRNA HyperPrep Kit for Illumina (Roche, #KR1352) following manufacturer’s instruction ...
-
bioRxiv - Genetics 2022Quote: ... a single ChIP and single input library was prepared from each of three plants using a KAPA HyperPrep kit (Roche #KK8502), amplified with 5 cycles of PCR ...
-
bioRxiv - Genomics 2022Quote: ... the fragments were treated with end-repair, A-tailing, and ligation of Illumina-compatible adapters (IDT, Inc) using the KAPA-Illumina library creation kit (KAPA biosystems). Plate-based DNA library preparation for Illumina sequencing was performed on the PerkinElmer Sciclone NGS robotic liquid handling system using Kapa Biosystems library preparation kit ...
-
bioRxiv - Immunology 2022Quote: ... Library quantification and quality checks were done using KAPA Library Quantification Kit for Illumina (#KK4824; Kapa Biosystems, Cape Town, South Africa), High Sensitivity D1000 DNA Kit on BioAnalyzer (#5067-4626/#5190-6502 ...
-
bioRxiv - Microbiology 2022Quote: ... The Kapa HyperPrep kit was used to prepare libraries from 50 μL of each sheared cDNA sample following modifications of the Kapa HyperPrep kit (version 8.20) and SeqCap EZ HyperCap Workflow (version 2.3) user guides (Roche Sequencing Solutions Inc.). Adapter ligation was performed for 1 hour at 20°C using the Kapa Unique-Dual Indexed Adapters diluted to 1.5 μM concentration (Roche Sequencing Solutions Inc.) ...
-
bioRxiv - Microbiology 2022Quote: ... Following DNA extraction Illumina shotgun sequence libraries were prepared using the Kapa HyperPrep kit according to manufacturer specifications (Roche; Basen, Switzerland). Libraries were sequenced on an Illumina NovaSeq S4 flow cell (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... genomic DNAs were fragmented using a Covaris S220 ultrasonicator and libraries were generated using KAPA LTP Library Preparation Kit (Roche, KK8230). To verify that the insertion was present in the genome at the correct location in both transfected lines ...
-
bioRxiv - Microbiology 2022Quote: ... hybridization and signal detection were carried out according to the instructions of the manufacturer (DIG RNA labelling kit and detection chemicals; Roche Diagnostics).
-
bioRxiv - Microbiology 2022Quote: ... automated extraction of total nucleic acids was performed on the MagNA Pure 96 system with the DNA and Viral NA Small Volume 2.0 kit (Roche, Meylan, France). HBV-DNA was quantified in IU/mL (WHO Standard ...
-
bioRxiv - Plant Biology 2022Quote: ... The libraries were constructed at the Genomics Core Facility at West Virginia University using the KAPA mRNA Stranded Kit (KAPA Biosystems), and then 150-bp paired-end sequenced at the BioHPC Lab at Cornell University using an Illumina NextSeq 500 platform ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Systems Biology 2022Quote: ... Libraries were prepared by the Genome Technologies core facility at The Jackson Laboratory using the KAPA mRNA HyperPrep Kit (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... Library construction of 300 ng total RNA for each sample was made using KAPA Stranded mRNA-Seq Kit (Illumina) (Kapa Biosystems), using 10 cycles of PCR amplification ...
-
bioRxiv - Genomics 2022Quote: ... sciMET(mg) and sciEM(combined n9 & mg) were performed using the KAPA qPCR Illumina library quantification kit (Kapa Biosystems Cat. KR0405) and the mean of each sciMET result (n9 = 397nM ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was performed with the KAPA SYBR Fast qPCR kit (KAPA Biosystems Cat# KK4608) on a CFX96 Real-Time PCR Detection System (Bio-Rad RRID ...
-
bioRxiv - Immunology 2022Quote: Viral RNA was extracted using the MagNA Pure 96 DNA and Viral Nucleic Acid kit on the MagNA Pure 96 system (Roche Diagnostics) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The fragments were treated with end-repair, A-tailing, and ligation of Illumina compatible adapters (IDT, Inc) using the KAPA-HyperPrep kit (KAPA Biosystems). The prepared libraries were quantified using KAPA Biosystems’ next-generation sequencing library qPCR kit and run on a Roche LightCycler 480 real-time PCR instrument ...
-
bioRxiv - Cancer Biology 2024Quote: ... The consecutive IF detection system for the above-mentioned sequence of antibodies was developed by using the Discovery FITC kit (catalog no. 760-232, Roche-Ventana), Discovery Red 610 (catalog no ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA quality was assessed by the Bioanalyzer RNA Nano Chip and depletion of rRNA prior to library generation was performed using RiboErase selection kit (Cat.# KK8561, Kapa Biosystems). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were developed by using either secondary antibodies linked to horseradish peroxidase with the UltraView™ Universal DAB Detection Kit (Ventana Medical System, Roche) or secondary antibodies linked to fluorophores ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-sequencing (RNA-seq) libraries were prepared using 750 ng of total RNA using the KAPA stranded mRNAseq kit (Roche, 8098123702) according to the manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2024Quote: ... assay was performed following our previous publication(4, 55) and the instruction of In Situ Cell Death Detection Kit TMR red (Roche, 12156792910). Cells were cultured on coverslips for 36 h ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and phoD-R1083 (5’-CTG SGC SAK SAC RTT CCA-3’) (Ragot et al., 2015) in 25 µL reactions with KAPA2G Robust HotStart PCR kit (KAPA Biosystems, Roche; 0.5 U KAPA2G Robust HotStart DNA Polymerase ...