Labshake search
Citations for Roche :
4551 - 4600 of 5245 citations for Human Cholecystokinin 12 CCK12 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... target sites were amplified directly from genomic DNA in the lysate using a KAPA HiFi HotStart PCR kit (KAPA Biosystems, KK2501) as previously described18 ...
-
bioRxiv - Genomics 2021Quote: ... 1-8 ng of ChIPed DNA was treated with end-repair, A-tailing, and ligation of Illumina compatible adapters (IDT, Inc) using the KAPA-Illumina library creation kit (KAPA biosystems). The ligated products were enriched with 8-10 cycles of PCR (HiFi premix ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA libraries were constructed for high throughput sequencing using the KAPA hyper Prep Library Preparation Kit (Kapa Biosystems, Woburn, MA). Mechanical DNA shearing was performed with the Covaris S220 through microTube-50 AFA Fiber Screw-Cap (Covaris® ...
-
bioRxiv - Developmental Biology 2020Quote: ... Library preparation for ChIP-sequencing (ChIP-seq) was performed as described 66 using the KAPA LTP Library Preparation Kit (KAPA Biosystems) and 2 ng of input DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... All PCR reactions were performed using SYBR-containing master mix from the KAPA Real-Time Library Amplification Kit (Kapa Biosystems #KK2702) and terminated in the mid-exponential phase to limit over-amplification ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were washed twice in cold PBS and total RNA was extracted using a High Pure RNA isolation kit (Roche 11828665001). Reverse transcribed RNA was used for sequencing by the University of Lausanne ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% CO2 by quantification of LDH released into cell supernatants by apoptotic/necrotic cells (LDH detection kit, Roche Applied Science, #11644793001). Maximal lysis of the target cells (= 100% ...
-
bioRxiv - Immunology 2021Quote: ... Tagmented DNA was ligated to a unique i5/i7 barcoded primer combinations using the Illumina Nextera XT Index Kit v2 and KAPA HiFi HotStart ReadyMix (Roche, #07958927001), and then purified using AmPure Beads XP (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... the DNA was ligated to i5/i7 barcoded primers using the Illumina Nextera XT Index Kit v2 and KAPA HiFi HotStart ReadyMix (2X; KAPA Biosystems). Next the DNA was purified using AmPure Beads XP (Agencourt) ...
-
bioRxiv - Neuroscience 2020Quote: ... Five hundred ng of RNA for each sample were reverse transcribed using the Transcriptor first strand cDNA synthesis kit (Roche, Germany). For real-time quantitative PCR reactions ...
-
bioRxiv - Neuroscience 2020Quote: TUNEL staining was performed according to the manufacturer’s instructions (In Situ Cell Death Detection Kit, Fluorescein, Roche, #11 684 795 910). In brief ...
-
Cell Ecosystem and Signaling Pathways of Primary and Metastatic Pediatric Posterior Fossa EpendymomabioRxiv - Cancer Biology 2020Quote: ... cDNA quality of the libraries was evaluated with a bioanalyzer and quantified using a KAPA Library Preparation Kit (Roche sequencing, KK4824). Libraries were sequenced using an Illumina NextSeq 500 on high output mode with 20 bp (read 1 ...
-
bioRxiv - Neuroscience 2021Quote: Cytotoxicity in the cell cultures (primary cortical neurons and cell lines) was assessed using the cytotoxicity lactate dehydrogenase (LDH) detection kit according to the manufacturer’s instructions (Roche, Basel, Switzerland). Furthermore ...
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry paraffin-embedded normal human skin and ES was stained for human Cytokeratin 5/6 according to the manufacturer’s protocol using a Ventana BenchMark Series automated slide stainer with ultraView Universal DAB Detection kit (Roche, 760-500).
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared by the Genome Technologies core service at The Jackson Laboratory using the KAPA RNA Hyper Prep Kit with RiboErase (HMR) (KAPA Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... The selected fragments were then end repaired, A-tailed and ligated to Illumina compatible adapters (IDT, Inc) using KAPA Illumina library creation kit (KAPA biosystems). Libraries were quantified using KAPA Biosystem’s next-generation sequencing library qPCR kit and run on a Roche LightCycler 480 real-time PCR instrument ...
-
bioRxiv - Bioengineering 2020Quote: ... The culture supernatant for each condition was harvested for RNA extraction using the HP Viral RNA Kit (Roche, Cat no. 11858882001) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... pGEM clones were linearized with NotI and transcribed with SP6 or T7 RNA polymerase using the DIG RNA labelling Kit (Roche 1277073) to generate antisense or sense probes ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting PCR products were purified and used as templates for in vitro transcription by employing DIG RNA Labeling Kit (SP6/T7) (Roche #11175025910). The resulting RNAs generated from SP6-mediated in vitro transcription were used as positive probes (cRNA ...
-
bioRxiv - Molecular Biology 2021Quote: 200 μL of eluate was extracted on the Magna Pure 96 using a DNA and Viral NA Small Volume Kit (Roche, 06543588001) with the universal small volume protocol and eluted into 50 μL proprietary elution buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... and samples (100 ng) were input in the RNA library construction using the KAPA RNA Hyper library prep kit (Roche, Switzerland). Customized adapters with unique molecular indexes (UMI ...
-
bioRxiv - Cancer Biology 2021Quote: LP-WGS libraries were prepared with 50 ng of sonicated tumor DNA (extracted from FFPE as described above) and patient-matched buffy coat DNA using KAPA Hyper-Prep Kit (KAPA Biosystems) with Illumina single index Tru-Seq adaptors (idtdna.com ...
-
bioRxiv - Cancer Biology 2021Quote: Sequencing libraries were prepared using 100-500 ng of cell free DNA (cfDNA) or sonicated genomic DNA using KAPA Hyper-Prep Kit (KAPA Biosystems) with Agilent SureSelect XT Target Enrichment System and Human All Exon V5 capture baits (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2020Quote: ... using primers 3PFK2fo2 and iPFK2re6 as well as the LightCycler FastStart DNA Master Plus Set SYBR Green I Kit (Roche Diagnostics) according to the instruction manual.
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Neuroscience 2019Quote: ... ATAC-Seq libraries were generated from transposed DNA using the Kapa Biosystems Real-Time Library Amplification kit (Kapa Biosystems, Cat. 07959028001) according to the manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... assay [31] was performed on cryosections of retinal explants using an in situ cell death detection kit conjugated with fluorescein isothiocyanate (Roche, 11684795910). DAPI (Vectashield Antifade Mounting Medium with DAPI ...
-
bioRxiv - Plant Biology 2021Quote: ... a digoxigenin-labeled probe corresponding to 415 bp of the ACMV AC1 gene was generated using a PCR DIG Probe Synthesis kit (Roche Diagnostics) and the primer pair ...
-
bioRxiv - Microbiology 2020Quote: ... The library pool was quantified with the KAPA SYBR FAST ABI Prism Library Quantification Kit (Kapa Biosystems, Inc., Woburn, MA, USA) and used for cluster generation on the cBot with the Illumina TruSeq SR Cluster Kit v3 ...
-
bioRxiv - Neuroscience 2021Quote: ... and RNA-Seq libraries were prepared from 500 ng total RNA using the KAPA Stranded RNA-Seq Kit with RiboErase (KAPA Biosystems) for rRNA depletion ...
-
bioRxiv - Microbiology 2020Quote: ... The final cDNA libraries were evaluated on the BioAnalyzer and quantified using the Kapa Library Quantification Kit (Roche Sequencing, Pleasanton, CA) by Molecular Genomics Core Facility (Moffitt Cancer Center ...
-
bioRxiv - Microbiology 2020Quote: ... The sgRNA expression cassettes were amplified from gDNA in a two-step nested PCR using KAPA HiFi HotStart ReadyMixPCR Kit (Kapa Biosystems). For PCR1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Hybridization was conducted according to the procedures described in the DIG High Prime DNA Labeling and Detection Starter kit II protocol (Roche®), using a 725-bp C-terminal TalCMAI1 amplicon as probe (Yu et al ...
-
bioRxiv - Plant Biology 2021Quote: ... The obtained library was amplified by emulsion polymerase chain reaction (PCR) using a GS FLK Titanium SV/LV emPCR Kit (Lib-L; Roche Diagnostics), added to a GS FLK Titanium PicoTiterPlate (Roche Diagnostics) ...
-
bioRxiv - Plant Biology 2020Quote: ... Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems, Wilmington, MA, USA) followed by size selection from 1.5kb to 3.5kb with a BluePippin system (Sage Science ...
-
bioRxiv - Zoology 2021Quote: ... a fragment of the EHP small subunit ribosomal RNA (SSU rRNA) gene was used to generate an EHP probe with a PCR-DIG labeling kit (Roche, Germany) ENF779 and ENR779 (Tangprasittipap et al. ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR amplification was performed using the LightCycler® 480 Probes Master Kit according to the manufacturer’s recommendations (Roche Diagnostics, Meylan, France). Each well contained 10 µL of mix ...
-
bioRxiv - Microbiology 2020Quote: ... The cDNA libraries were quantitated using qPCR in a Roche LightCycler 480 with the Kapa Biosystems kit for Illumina library quantitation (Kapa Biosystems) prior to cluster generation ...
-
bioRxiv - Pathology 2021Quote: ... The obtained individual libraries were also quantified by an Agilent 2100 Bioanalyzer using a DNA7500 LabChip kit and an equimolecular pool of libraries were titrated by quantitative PCR using the “Kapa-SYBR FAST qPCR kit for LightCycler 480” (Kapa BioSystems) and a reference standard for quantification ...
-
bioRxiv - Microbiology 2019Quote: ... and pooled for Illumina MiSeq sequencing using custom sequencing primers and the MiSeq Reagent v2 500 cycle Kit (Roche, Branford, CT) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... DNA extractions performed at the MPI-SHH substituted the column apparatus from the High Pure Viral Nucleic Acid Large Volume Kit (Roche, Switzerland) in place of the custom assembled Zymo-reservoirs coupled to MinElute (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: An antisense RNA DIG-probe was generated by transcription from linearized pCS1 vector containing Sorbs1 coding sequence using SP6 RNA polymerase kit where UTPs were labelled with digoxigenin (DIG) (Roche, 11175025910).
-
bioRxiv - Genomics 2020Quote: ... Note that all other characteristics observed for a retrotransposon insertion when using the exome capture kit from Roche (see Figure 2) are also observed when using the kit from Agilent.
-
bioRxiv - Cancer Biology 2020Quote: Approximately 500ng of FFPE RNA or 100ng of fresh frozen RNA per sample were used for RNA library construction using the KAPA RNA Hyper library prep kit (Roche, Switzerland) per the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... three-to-four 5μm FFPE samples sections were taken for RNA extraction using commercial FFPE nucleic acid isolation kit (Roche Molecular Diagnostics). RNA was quantified using Nanodrop and analyzed for fragment distribution using a bioanalyzer (Agilent) ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-sense-tiRNA DNA oligos were ordered from IDT and labelled with DIG using the DIG Oligonucleotide Tailing Kit (Roche, 03353583910). Sequences of the probes are ...
-
bioRxiv - Neuroscience 2020Quote: ... The stained cells were further labelled by TUNEL (TdT-mediated dUTP-X nick end labeling) with an In-Situ Cell Detection Kit (TMR red) from Roche (12156792910). Fluorescent images were collected on a Zeiss Automatic stage microscope with Zen blue software ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription from RNA to cDNA was performed with the Transcriptor Universal cDNA Master kit from Roche (Ref. 05893151001, lot. 32966400). The semiquantitative real-time PCR was proceeded with the faststart universal SYBR green master from Roche (Ref ...
-
bioRxiv - Cell Biology 2020Quote: ... Accurate quantification for sequencing applications was performed using qPCR-based KAPA Biosystems Library Quantification kits (Kapa Biosystems, Inc., Woburn, MA, USA). Each library was diluted to a final concentration of 1.25 nM and pooled in equimolar ratios prior to clustering.
-
bioRxiv - Plant Biology 2022Quote: ... The primers designated ‘forward’ (GCCTTTTCAGCAAGATGCCG) and ‘reverse’ (GTACTCCCTCCGCTCCAAAAT) were used to perform PCR amplifications with the Kapa HiFi HotStart PCR kit (Kapa Biosystems, Roche). The reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems ...