Labshake search
Citations for Roche :
401 - 450 of 8573 citations for N' 4 Dimethylamino phenyl methyl 5 methyl 1 2 oxazole 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Hmef1a_R_val1_193: 5′-CCGTTAAGGAGCTGCGTCG-3′), and KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) in a LightCycler 96 system (Roche, Basel, Switzerland). The qPCR reaction was made with 5 µl KOD SYBR (TOYOBO) ...
-
bioRxiv - Genomics 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Bioengineering 2024Quote: ... in PBS (PBST) and then blocked for 3 hours at RT in PBS with 5 wt% bovine serum albumin (BSA, Roche), 5% goat serum (Gibco) ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...
-
bioRxiv - Microbiology 2024Quote: ... T the gels were electroblotted on positively charged nylon membranes (Amersham Hybond-N RPN 203 N) followed by UV crosslinking and hybridised in DIG EasyHyb buffer (Roche) at 68 °C with gentle agitation overnight ...
-
bioRxiv - Immunology 2024Quote: ... gel bands corresponding to the LRP1 protein were excised and the N-glycans were attained from an overnight in-gel N-glycan release with 2U PNGaseF (Roche) at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and Str tissue from old (N =6 wt, N =8 tgNM) mice were homogenized in RIPA buffer supplemented with protease inhibitors (Roche) and cell extracts clarified by centrifugation at 13000g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Immunology 2024Quote: ... beads and lysis buffer (20 mM Tris pH 7.4, 120 mM NaCl, 1 mM EDTA, 1% Triton-X-100, 0.5% sodium deoxycholate, 1× protease inhibitor cocktail [Roche])) ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... After incubating in primary antibodies for two hours and DAPI (4′,6-diamidine-2′-phenylindole dihydrochloride, Sigma Aldrich, 10,236,276,001 Roche) for the last ten minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... the samples were incubated with 4′,6-diamidino-2-phenylindole (DAPI; F. Hoffmann-La Roche, Natley, NJ, USA) and appropriate donkey anti-mouse/rabbit/rat/chicken secondary antibodies conjugated to Alexa Fluor 488 ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Microbiology 2021Quote: ... 3 mM DTT and 1 mM PMSF) supplemented with protease inhibitor cocktail (Roche). Zirconium beads equivalent to 100 µL volume was added in microcentrifuge tubes and resuspended cells were lysed by 6 rounds of bead beating on a bullet blender ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Genetics 2024Quote: ... in 300-Wash Buffer (1 mL 1M HEPES pH 7.5, 3 mL 5M NaCl, 12.5 µL 2M spermidine, and 1 Roche c0mplete Protease Inhibitor EDTA-free tablet with ddH2O to 50 mL ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM EDTA) supplemented with phosphatase inhibitors (5 mM ß-glycerophosphate, 5 mM NaF, 1 mM Na3VO4) and protease inhibitors (Roche cOmplete ULTRA Tablets, EDTA-free). The lysates were sonicated on ice (4x 10s bursts ...
-
bioRxiv - Microbiology 2024Quote: ... Cobas TaqMan RealTime HIV-1 (version 1 or 2; Hoffmann-La Roche, Basel, Switzerland) or the Abbott RealTime HIV-1 assay (Abbot Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a 2:1:1 ratio using X-tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Neuroscience 2024Quote: ... specific digoxigenin (DIG)-labeled RNA probes and performed nitro blue tetrazolium (NBT)/ 5-bromo-4-chloro-3-indolyl-phosphate color-reaction (BCIP) after wash and incubation with anti-digoxigenin antibody (catalog. no. 11093274910; Roche; RRID: AB_514497) as previously reported (Zempo et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... 100 µl 10% SDS, 500 µl 20% N-Lauroyl sarsosine sodium, 2 tablets of cOmplete ULTRA Protease Inhibitor Cocktail [Roche Cat.# 05892970001] in 10ml FA buffer). For each IP experiment ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche). Insoluble debris was removed by centrifugation at 15000 rpm for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... The beads were then collected at 1000 g for 2 min and washed at least 3 times with lysis buffer coupled with protease inhibitor cocktail (Roche). After last wash and centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Biophysics 2024Quote: ... 150 mM NaCl and 2 mM CaCl2 (“Na + Ca”) were incubated at 37° C with Proteinase K (3 μg/ml) (Roche). Aliquots are removed at different time intervals following addition of the protease (0 ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were diluted 1:4 with ice-cold dilution buffer (1× phos-stop [Roche], 0.5% NP-40, 1 mM DTT) and centrifuged again at 15,000 rpm for 15 minutes at 4°C to precipitate actomyosin components ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% Triton X-100) with 2% complete protease inhibitor (Roche) for 20min on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM β-mercaptoethanol in presence of Dnase 1 (Roche), EDTA-free protease inhibitor coctail (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM benzamidine) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Microbiology 2023Quote: ... 1% P/S and 50 U/mL IL-2 (Roche), at 37°C and 5% CO2.