Labshake search
Citations for Roche :
201 - 250 of 8573 citations for N' 4 Dimethylamino phenyl methyl 5 methyl 1 2 oxazole 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... and amplified 6 times (Sets 1 and 2) or 8 times (Set 3) with a KAPA Library Amplification Kit (KAPA Biosystems). The amplification products were cleaned using Agencourt Ampure XP reagent or KAPA Pure Beads ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 mM N-ethylmaleimide and Complete protease inhibitor cocktail (Roche, one tablet/10 ml of buffer). HA-tagged ubiquitin was purified using Pierce anti-HA magnetic beads (clone 2–2.2.14) ...
-
bioRxiv - Cancer Biology 2024Quote: ... N-glycopeptides were enzymatically de-glycosylated and eluted from the beads with 5 U of PNGase F (Roche) in 100 mM NH4HCO3 at 37°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Molecular Biology 2021Quote: T98G cell pellets were fixed by dropwise addition of cold 70% ethanol and their DNA was stained with 4’,6-diamino-2-phenylindole (1 μg/ml, Roche), 0.1% Triton X-100 in phosphate-buffered saline (PBS) ...
-
bioRxiv - Genomics 2020Quote: ... Real-time quantitative PCR reactions were set up in triplicate with 2 μL of cDNA (1:4 dilution) per reaction using the FastStart Universal SYBR Green Master mix (Rox) (Roche) and run on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... The primary antibodies and respective concentrations used in this study are the following: 4’,6-diamidino-2-phenylindole (DAPI) (1:500, Roche), anti-Ki67 (1:100 ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... parasite cultures were incubated for 20 min at 37 °C in RPMI containing 1 µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche) or 2.5 µM Bodipy-TR-C5-ceramide (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... N-Glycans were released by 10 U N-glycosidase F (Roche) digestion in 50 mM NH4HCO3 buffer pH 8.4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... For N-glycan release 2.5 U N-glycosidase F (Roche, DE) were added and the resulting mixture was incubated overnight at 37°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... mice (n=2 per group) were randomly assigned to receive either diazepam (synthesized by F. Hoffmann-La Roche) 0.3 ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Microbiology 2024Quote: ... with their respective dilution in 5% skimmed milk in PBS-tween 0.1% were used: anti-HA-HRP (3F10) (N°12013819001, Roche) 1/10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Neuroscience 2024Quote: ... and stressed (n=4) DA neurons to prepare stranded RNAseq libraries following manufacturer’s recommendations using KAPA mRNA hyperprep (Roche Diagnostic). Each final library was quantified and qualified with 2200 Tapestation (Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...
-
bioRxiv - Biophysics 2023Quote: ... solubilized with 1 % final concentration n-Dodecyl β-D-maltoside (Roche, Mannheim, Germany) and incubated for 5 min at 25 °C ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Cancer Biology 2020Quote: Cell (1 × 104) proliferation was measured using the 5-Bromo-2′-deoxy-uridine Labeling and Detection Kit III (Roche, Mannheim, Germany) (Jin ...
-
bioRxiv - Neuroscience 2020Quote: ... 40 mM KCl, 5 mM EGTA, 5 mM MgCl2, 5 mM DTT, 1 mM PMSF, 1% Triton X, protease inhibitor Roche complete, pH 7.2) and sonicated at low power for 5 s ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets of harvested bacteria were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Biochemistry 2021Quote: ... The pellets were resuspended in 5 mL of lysis buffer (20mM NaP pH 7.5, 300mM NaCl, 15mM imidazole, 5% glycerol, 0.5mM TCEP, 1 mg/ml lysozyme, 5 U/ml DNase, 1 Roche protease inhibitor tablet/100mL) per 1 g of wet weight culture ...
-
bioRxiv - Cell Biology 2021Quote: Total protein from cells or mouse tissues (n=3 per genotype) were extracted using the M-PER protein lysis buffer (ThermoScientific, Beverly, MA) containing protease inhibitors (Roche, Indianapolis, IN). Approximately 25 μg of total protein was electrophoresed on 4-12% SDS-PAGE gels and transferred to PVDF membranes ...
-
bioRxiv - Physiology 2022Quote: ... n=3/genotype) were used for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) to visualize cell apoptosis/death (Roche, Basel, Switzerland). Sections were counterstained with DAPI and visualized using epifluorescence (Nikon Eclipse Ni E800) ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... sections were blocked with 10% HI-serum for 2 h and incubated overnight at 4°C with alkaline phosphatase-labeled sheep anti-dig antibody (11093274910, Roche; 1:2500). After washing ...
-
bioRxiv - Cell Biology 2023Quote: ... cover slips were washed with PBS and incubated for 10 min at room temperature with 1 g/mL 4’,6 diamidino-2-phenylindole (DAPI, Sigma Aldrich, Roche, #10236276001) in PBS ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Neuroscience 2020Quote: ... Then embryos were incubated for 2 hours in 5% Blocking Reagent (Roche) in MAB (150 mM maleic acid ...