Labshake search
Citations for Roche :
501 - 550 of 8573 citations for N' 4 Dimethylamino phenyl methyl 5 methyl 1 2 oxazole 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 1% Triton X-100 and 5% glycerol) supplemented with protease inhibitor (Roche), 1 μL/mL Ready-Lyse™ Lysozyme Solution (Lucigen ...
-
bioRxiv - Cancer Biology 2020Quote: ... NE were diluted 1:5 in IP buffer with protease inhibitor (Roche). NE was incubated overnight at 4°C on rotating wheel with 10 ug of G9a antibody (Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... 1% Triton X-100 and 5% glycerol) supplemented with protease inhibitor (Roche), 1 μL/mL Ready-LyseTM Lysozyme Solution (Lucigen ...
-
bioRxiv - Developmental Biology 2024Quote: ... the embryos underwent blocking with 1:5-diluted Western Blocking Solution (Roche) for 1 hour at room temperature under agitation ...
-
bioRxiv - Microbiology 2022Quote: Fresh pre-cut pancreatic tissue (2 × 2 mm) were digested with a solution of collagenase P in HBSS-1% HEPES (0.75 mg/mL, Roche) at 37°C for 7 min with shaking ...
-
bioRxiv - Plant Biology 2023Quote: ... in 100μl extraction buffer (Tris-HCl 50 mM pH 6.8, SDS 2%, DTT 2 mM and 1× protease inhibitors (Roche) and centrifuged for 5 min at 13,000g at 4OC ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted in PBS for 2 hours at room temperature after which they were counterstained with 300 nM 4’,6’-diamino-2-phenylindole (DAPI; 10236276001, Roche) for 5 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were then blocked in blocking solution (maleic acid buffer containing 2% Boehringher-Mannheim blocking reagent) and incubated overnight at 4°C in blocking solution containing anti digoxigenin antibody (Roche) diluted at 1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was diluted to 2 ng/µL and 4 µL were added to 10 µL 2x FastStart Universal SYBR Green PCR Master (Roche). Each sample was run in triplicate using iTaq Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Genetics 2023Quote: ... for 30 min at room temperature and incubated for 2 h at room temperature or overnight at 4°C with primary antibodies against GFP (Roche), androgen receptor (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were synthesized at 37°C for 2–4 hrs in digoxigenin-synthesis reaction mixture with T7 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with 1X PBS before nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Roche) for 10 min at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 μL of whole cell extract (WCE) was incubated overnight at 4°C with 2 μg anti-c-myc antibodies (mouse monoclonal, clone 9E10, Roche) for immunoprecipitation of myc-tagged proteins ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 2 µg/ml capture antibodies in PBS at 4°C overnight and blocked with blocking buffer containing 2% BSA fraction V (Roche) in PBS-T (0.05% Tween-20 (Daejung ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in Buffer A (2 M NaCl, 20 mM HEPES pH 7.5, 20 mM Imidazole, 5 mM βME, protease inhibitor (Roche)) by sonication ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
bioRxiv - Physiology 2024Quote: Fibroblast proliferation was assessed using a 5-bromo-2’-deoxyuridine (BrdU) incorporation assay (colorimetric) from Roche (Indianapolis, IN, USA) for 48 h following the manufacturer’s instructions.
-
Conserved Cis-Acting Range Extender Element Mediates Extreme Long-Range Enhancer Activity in MammalsbioRxiv - Genomics 2024Quote: ... embryos were with PBT (x3, 15mins) and incubated in prehybridization buffer (50% deionized formamide, 5× SSC, pH 4.5, 2% Roche Blocking Reagent ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1% (v/v) 2-mercaptoethanol and 1× protease inhibitors (Roche; 11836170001). Insoluble material was removed by centrifuging at >12,000 × g for 10 min at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche). The cells were then lysed by sonication and cell debris was removed by centrifugation at 30,000 g for 45 min at 4° C ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg ml-1 pepstatin and protease inhibitor cocktail tablets (Roche) and lysed with an EmulsiFlex-C3 homogenizer at pressures above 20,000 psi ...
-
bioRxiv - Cell Biology 2022Quote: ... or with 1:10 Dnase I (stock 2 U/μL, Roche), and micrococcal nuclease (stock 2000 U/μL ...
-
bioRxiv - Immunology 2022Quote: ... 2 ml of DMEM with 0.26 U ml−1 LiberaseTM (Roche) and 0.25 mg ml−1 DNase I (Roche ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM PMSF and 2 tablets cOmplete protease inhibitor (Roche #5056489001) per 50 mL of lysate ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM EDTA and 2 × Complete protease inhibitor (Roche, Indianapolis, IN) on ice for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and glands minced with surgical scissors before enzymatical dissociation for 1.5h in DMEM/F12 (1:1) supplemented with 2 mg mL−1 collagenase (Roche) + Gentamicin (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA (50 μg) was separated on 1% agarose–formaldehyde gels and transferred to Hybond-N+ nylon membranes (Roche, Basel, Switzerland). Northern blotting was conducted with biotin-labeled DNA (bio-CTGTAGAAAGTCTGCTGATCGATACCGCGACG ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Blocking of membranes was carried out in buffer 2 (buffer 1 plus 1% blocking reagent (Roche)) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... constructs in 6:3:1 weight ratios by X-Treme Gene HP Transfection Reagent (Roche) or the calcium phosphate method ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Neuroscience 2021Quote: ... 100 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 5% glycerol, and 0.1% Triton X-100 supplemented with Roche Protease Inhibitor cocktail) and then roc ked for 10 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... destained and digested with Asp-N (Roche, 20 ng/μL) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... N-trimethyl-ammonium methylsulfate (DOTAP) (Roche Applied Sciences, Indianapolis, IN), which showed high efficacy for in vivo transfection [31] ...
-
bioRxiv - Microbiology 2021Quote: ... monocytes were harvested using ice-cold lysis buffer (1% Triton X-100, 2% SDS, 150 mM NaCl, 10 mM HEPES, 2 mM EDTA containing protease inhibitor cocktail - Roche). Cell lysates were heated at 100 °C for 5 min in the presence of Laemmli buffer (20% β-mercaptoethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... 150 mM NaCl, 20 mM KCl, 2 mM MgCl2, 1% TX-100, 40U Ribolock ml-2 and protease inhibitor cocktail, Roche) followed by clearing at 17 000 × g for 10 min at +4C° ...
-
bioRxiv - Cell Biology 2023Quote: 12-16 hours old embryos were collected and lysed in homogenization buffer (25 mM Hepes pH 7.4; 150mM NaCl; 0.5mM EDTA pH 8.0; 1 mM DTT and 1 tablet of proteinase inhibitor cocktail; Roche 11836170001). The aqueous phase of the lysate was collected after 1 hour of centrifugation at 4°C and centrifuged again for 25 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 M urea, 0.5% SDS, 1 mM EDTA pH8.0, 1 mM DTT, and 1× protease inhibitor cocktail [Roche, cat#4693132001]). Biotinylated RBPs were captured by affinity purification ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM Tris-HCl pH 8.0, 5% glycerol, 1 mM DTT, 0.1% CHAPS, 1 μg/mL avidin, cOmplete, EDTA-free protease inhibitors [Roche]), rotated at 4°C for 30 min ...