Labshake search
Citations for Roche :
3351 - 3400 of 8835 citations for FH1 FH2 domain containing protein 1 FHOD1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... then subject to gentle cold digestion on ice using 10% FBS-supplemented RPMI media containing 100mg/mL trypsin inhibitor from soybean (Roche, 10109886001), 10mg/mL collagenase A from clostridium histolyticum (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Three trachea from either wild-type or Trp73-/- mice were pooled together in 15 mL falcon tubes containing 2 mL 0.15% filter sterilised Pronase (Roche, Basel, Switzerland) and incubated at 4°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... the T cells were activated in X-VIVO 15 containing 150 U/mL of human IL-2 (#Ro 23-6019, Roche, Switzerland), 10 ng/mL of recombinant IL-7 (#200-07 ...
-
bioRxiv - Biochemistry 2023Quote: ... qPCRs reactions were prepared in a 20 uL final volume containing Fast Start Universal SYBR Green Master (Rox) (Roche Applied Science), cDNA template ...
-
bioRxiv - Microbiology 2023Quote: ... The cell pellet was resuspended in chilled lysis buffer (Bugbuster) containing one dissolved cOmplete™ EDTA-free Protease Inhibitor cocktail tablet (Roche). The cell lysates were clarified by centrifugation (11,000 × g ...
-
bioRxiv - Immunology 2023Quote: ... Uteri were isolated and carefully dissected to remove the yolk sac containing the fetus followed by mechanical disruption and digestion with DNase I 200 units/mL (Roche 10104159001) and Liberase DL 0.3 W units/mL (Roche 05466202001 ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 μl papain inhibitor solution containing 5 mg/ml BSA (Carl Roth, 8076.4) and 5 mg/ml Trypsin inhibitor (Sigma-Aldrich/Roche, 10109878001) in PBS was added ...
-
bioRxiv - Pathology 2023Quote: ... The tissues were cut into small pieces with scissors and incubated in 3mL of RPMI containing 900µg of Liberase TM (Roche, Basal, Switzerland) and 150µg DNase I (MP Biomedicals ...
-
bioRxiv - Microbiology 2023Quote: ... cells were washed 2X with cold DPBS++ and RIPA buffer (Pierce #89900) containing complete EDTA-free protease inhibitor cocktail (Roche #11873580001) was added to wells ...
-
bioRxiv - Molecular Biology 2023Quote: Antisense and sense digoxigenin- and biotin-labeled riboprobes of AcerOr11 were synthesized using linearized pGEMHE plasmids containing appropriate insertion sequences as a template using the DIG and Biotin RNA Labeling Mix (Roche, Germany) and T7 RNA Polymerase (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were homogenized on ice in lysis RIPA buffer (Thermo Fischer Scientific, Waltham, USA) containing protease inhibitor cocktail (Roche Diagnostics, Switzerland). Sodium dodecyl sulfate (SDS ...
-
bioRxiv - Developmental Biology 2024Quote: ... The discs were dissected in pre-cooled PBS and pipetted in PBT (PBS, 0.1 % Triton X-100) containing 1x proteases inhibitors (cOmplete™ Protease Inhibitor Cocktail tablets, Roche, 11873580001). The disks were incubated in PBT with 1x protease inhibitors and 0.4 % IGEPAL CO-630 (Sigma ...
-
bioRxiv - Synthetic Biology 2024Quote: ... plasmids to be barcoded were diluted to 2 ng/µl and PCR amplified using the primers containing the full barcode sequence using KAPA HiFi HotStart ReadyMix (KK2602, Roche, USA). Barcoded PCR products were run on a 1.2% agarose gel ...
-
bioRxiv - Genetics 2023Quote: ... qPCR was performed in a final volume of 20 μl containing 20 ng of total DNA using SYBR Fast Universal qPCR Kit (Kapa Biosystems) and analysed using the Quant Studio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... Tissues including brain and kidney were collected and rinsed twice with cold PBS containing phosphatase and protease inhibitors (PhosSTOP, Merck #04906837001, and complete EDTA-free Protease Inhibitor Cocktail, Roche #11836170001) before being snap-frozen ...
-
bioRxiv - Molecular Biology 2024Quote: Whole cell extracts from cultured cells were prepared by direct lysis and sonication of cells in 2% SDS sample buffer containing phosphatase and protease inhibitors (Roche, Germany). Cell extracts were separated in denaturing 8% or 15% (used only for CDKN1A ...
-
bioRxiv - Physiology 2024Quote: ... TA muscles were dissociated and digested in DMEM F/12 medium containing 10 mg/ml of collagenase B and 2.4 U/ml Dispase (Roche Diagnostics GmBH) at 37°C for 30 min and passed through a 30 μm cell strainer ...
-
bioRxiv - Physiology 2024Quote: ... myotubes were washed using PBS then harvested by adding 50 μl Radioimmunoprecipitation Assay (RIPA) buffer containing protease inhibitors (Roche, Basel, Switzerland). Myotubes where scraped from the well and lysates centrifuged at 12000g for 5 min and supernatant collected ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ng of the remaining amplified cDNA from each sample was first used in a 100uL reaction containing 50uL KAPA Hifi Mastermix (Roche 7958935001), 0.5uL 100uM forward primer that binds to the WPRE3 in the AAV vector 5’ AACTCATCGCCGCCTGCCTTG 3’ and 0.5uL 100uM reverse primer that binds to Read 1 (part of the oligo attached to the 10X gel bead ...
-
bioRxiv - Biochemistry 2024Quote: ... cells at 40% confluency were transfected with 1 µg of mammalian expression plasmid DNA containing gene of interest using 3 µL X-tremeGENE 9 DNA transfection reagent (Roche, 6365809001) diluted in 100 µL 1x OPTI-MEM I reduced serum medium (Gibco ...
-
bioRxiv - Genomics 2024Quote: ... cleaned ligated products were PCR amplified in a 50 µL reaction volume containing 10.0 µL Kapa HiFi Buffer (Roche, Basel, Switzerland), 1.5 µL dNTPs (10 mM) ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were rinsed with ice-cold PBS and lysed with radioimmunoprecipitation buffer assay (RIPA) containing protease and phosphatase inhibitor cocktail (Roche; #05892791001) and incubation on ice for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... minced, and digested in 1x PBS containing 150 μg/ml collagenase (MilliporeSigma, C5138) and 20 U/ml DNase I (Roche, 04716728) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The pellet was washed with 500 μL of ethanol 70 % and dried at room temperature resuspended in 40 μL of TE containing 20 μg/μL of RNase (Roche, 10109169001) and incubated 30 minutes ...
-
bioRxiv - Genetics 2024Quote: ... the target region containing the gRNA-targeting site was amplified from individual genomic DNA using KAPA HiFi (Roche Diagnostics, Basel, Switzerland) with a primer pair containing barcode and overhang adaptor sequences ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we prepared four PCR reactions with a total volume of 50 µL containing 1X Kapa Hifi Buffer (Kapa Biosystems, USA; Kapa), 0.3 µM iTru5-8N Primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 uL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-PARP1 1:1000 (1 835 238 Roche), anti-tubulin 1:5000 (B-5-1-2 Santa Cruz) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GFP (mouse, Roche AB_390913, Substrate 1:1); anti-actin (mouse ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL of 1 mg/mL pyrophosphatase (Roche) was added to each reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... HA-HRP (Roche, 12013819001, 1:1,000-1:5,000), MPP6 (Atlas antibodies ...
-
bioRxiv - Plant Biology 2023Quote: ... Meristem-enriched samples or whole seedlings were ground in liquid nitrogen and homogenized in cold protein extraction buffer (50 mM Tris HCl pH 7.5, 10% glycerol, 1 mM DTT, 1% IGEPAL, 1× Roche EDTA-free protease inhibitor and 1× Roche phosphatase inhibitor). The homogenate was centrifuged and the protein concentration of the supernatant was measured using a Pierce 660 nm Protein Assay Reagent (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail). Cell lysates were prepared by bead-beating ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 mM EDTA, 1 mM EGTA, 1.5 mM MgCl2, 1% Triton X-100, 10% Glycerol, 1 mM DTT, Roche complete protease inhibitor) with 0.5 mg/mL Lysozyme and placed on a roller for 45 minutes at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1mM EGTA, 1% Triton X-100, 0.4% SDS, 1% NP-40, 1× Roche protease inhibitor cocktail), one time with wash buffer B (50 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 3 mM ATP, 10% sucrose and Roche protease inhibitors). For sS1 constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10% sucrose, 3 mM ATP, 1 mM DTT, 1 mM PMSF and Roche Protease Inhibitors), 1 ml per dish ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl, 10% sucrose, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 3 mM ATP, 1 mM PMSF and Roche protease inhibitors). Native mouse regulatory light chain (RLC ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.05% NP-40, 10% glycerol, 1×Roche protease inhibitor cocktail) and were lysed by beating with 0.5-mm-diameter glass beads using a FastPrep instrument at a speed of 6.5 m/s for three cycles of 20 seconds each ...
-
bioRxiv - Microbiology 2020Quote: ... Protein lysates were obtained by lysing cells in 0.1% SDS and protease inhibitor cocktail tablets (Roche #04693124001). Cell lysates were separated by SDS-PAGE (Bio-Rad 4-20% Mini-PROTEAN TGX Precast Gel ...
-
bioRxiv - Plant Biology 2021Quote: ... The eluted proteins were subjected to 10% SDS-PAGE gels for immunoblot analyses using anti-GFP (Roche) and anti-Myc (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse/rabbit IgG overnight at 4°C and further with protein G-coupled agarose beads (ROCHE) for 1-2 h ...
-
bioRxiv - Cell Biology 2020Quote: Cells were lysed and proteins were purified by Complete™ Lysis-M EDTA-free kit (Roche, 04719964001). Protein samples were run on Mini-PROTEAN® TGX™ Precast Gels (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: Total proteins were extracted from cells using RIPA lysis buffer with a protease inhibitor cocktail (Roche, Germany). The proteins were quantified using Thermo Scientific Pierce BCA Protein Assay ...
-
bioRxiv - Microbiology 2020Quote: Protein lysates of HEK-293T cells were extracted with RIPA buffer (PIERCE) and protease inhibitor cocktail (Roche). Loading buffer (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... The His6-tag fusion proteins were purified with a cOmplete™ His-tag purification resin (Roche, Merck). The fusion proteins were cleaved by incubation with thrombin protease (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... (a) Proteins were extracted from cryogrinded cell powders with different extraction solutions supplemented with protease inhibitors (Roche) (solution compositions listed in Supplementary Table 1) ...
-
bioRxiv - Bioengineering 2020Quote: ... and protein was extracted via Dounce homogenizer in a cocktail of RIPA buffer (Thermo) and proteinase (Roche) supplemented with phosphatase (Roche ...
-
bioRxiv - Cell Biology 2020Quote: Whole cell or mitochondrial samples were lysed in RIPA buffer supplemented with cOmplete protein inhibitor cocktail (Roche) and 1mM phenylmethylsulfonyl fluorid (PMSF) ...
-
bioRxiv - Genetics 2020Quote: ... we assessed levels of protein in mice urine using Chemstrip® 10 (Roche Diagnostics GmgH, Mannheim, Germany).