Labshake search
Citations for Roche :
3501 - 3550 of 8835 citations for FH1 FH2 domain containing protein 1 FHOD1 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 1% NP-40 and 1× protease inhibitor cocktail (cOmplete, Roche), phosphatase inhibitor cocktails I and II (Millipore) ...
-
bioRxiv - Genomics 2020Quote: ... 1 protease inhibitor tablet (Roche Complete cat #1 697 498) per 50ml buffer) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% SDS solution after adding protease inhibitor (Roche 4693116001; 1×) and phosphatase inhibitor cocktails (Roche 4906845001 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM DTT) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM DTT) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM DTT) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM DTT) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM DTT) + protease inhibitors (1 tablet / 50 ml Roche Complete Ultra EDTA-free ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% NP-40 and 1× complete protease inhibitor cocktail (Roche)) by three rounds of chopping the tissue using dissection scissors and a handheld homogenizer7 ...
-
bioRxiv - Microbiology 2020Quote: ... The cross-linking reaction was quenched by incubating the cells with 0.125 M glycine for 5 min with mild agitation at room temperature followed by centrifugation at 3,000 rpm for 5 min at 4°C with a subsequent PBS wash (containing 0.01X protease inhibitor cocktail or PIC; #11836170001, Roche Applied Science, Indianapolis, USA). Following the complete removal of PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM EDTA) containing phosphatase inhibitors (10 mM sodium pyrophosphate, 20 mM β-glycerophosphate, 100 mM NaF) and protease inhibitor cocktail (Roche Applied Science). Protein extracts were incubated with each antibody with rotation for 2 hr and then added to protein A/G agarose beads (Santa Cruz ...
-
Proto-sex locus in large yellow croaker provides insights into early evolution of the sex chromosomebioRxiv - Evolutionary Biology 2020Quote: ... The DNA probes constructed from a BAC clone containing dmrt1 (supplementary note 11) were labeled with biotin-11-dUTP using a Nick Translation System (Roche Diagnostics, Basel, Switzerland). The probes were added to the hybridization buffer ...
-
bioRxiv - Developmental Biology 2020Quote: Approximately 100 mg of minced PND12 rat ovary tissue was digested in 1ml of digestion medium [199 media containing 0.08 mg/ml of liberase with medium-concentration of thermolysin (Roche Diagnostics GmbH, Mannheim, Germany) supplemented with 5U/ml of DNase I and 1% BSA (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... The extracted viral DNA and a serial dilution of the transfer plasmid DNA containing the WPRE sequence were transferred to a 96 well plate and measured using a LightCycler® 96 instrument (Roche Life Science). AAVs produced had a titer of 2.10 × 1013 viral genomes/ml.
-
bioRxiv - Molecular Biology 2020Quote: ... followed by incubation (16 h at 4 °C) in the presence of 10 pM TBST containing complete TM protease inhibitor cocktail (Roche Pharma, Basel, Switzerland). The membranes were washed three times with TBS (150 mM NaCl ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified in 50 μl reactions containing 150 pmol of P1.1 and P3 primer and Kapa HiFi HotStart Library Amplification kit (Cat# kk2612, Roche Sequencing and Life Science). The amplification was incubated at 95°C for 45 seconds ...
-
bioRxiv - Systems Biology 2021Quote: Frozen cell pellets were resuspended in 1x IPOD lysis buffer (10 mM Tris HCl, pH 8.0; 50 mM NaCl) containing 1x protease inhibitors (Roche Complete Mini, EDTA free) and 52.5 kU/mL of ready-lyse (Epicentre) ...
-
bioRxiv - Cell Biology 2022Quote: ... triton X-100 in HBSS for 10 min and incubated with blocking solution containing 2% (w/v) bovine serum albumin fraction V (Roche, Woerden, The Netherlands) and 0.1% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Freshly frozen hearts were homogenized in RIPA buffer containing phosphatase inhibitor cocktail I (Wako) and protease inhibitor tablet mini (Roche, cOmplete™, Mini), using a hand held homogenizer on ice for 1 min ...
-
bioRxiv - Microbiology 2021Quote: 48 h bacterial cultures were pelleted and were resuspended in RIPA buffer containing protease inhibitors cocktail (Roche, Cat. No. 11 836 145 001). Samples were sonicated at 50% voltage for 5 cycles of 10 sec pulses followed by 30 sec rest on ice ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were washed with ice cold PBS and lysed in RIPA buffer containing phosphatase and protease inhibitors (Roche, South San Francisco, CA). For mouse and human biopsies ...
-
bioRxiv - Neuroscience 2021Quote: Samples from the 2D cultures or brain organoids were collected in RIPA buffer containing protease inhibitors (Complete mini, Roche Applied Science, Penzberg, Germany) and sonicated two times at 60% - 70% during 10 s before use for the western blotting analyses ...
-
bioRxiv - Neuroscience 2022Quote: ... They were scooped with a brush and dropped in a glass tube containing the homogenization buffer (HB; 0.32 M sucrose and one tablet Complete mini EDTA-free protease inhibitor cocktail (Roche; 10 ml, pH 7.4)) at 4°C (50 μl of buffer for each slice) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CaCo-2 and Vero cells seeded at a density of 5 × 103 cells and 7 x 103 per well in 200 μl media containing 10% FBS in a 16-well E-plate (Roche Applied Science, Germany), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... tissues or cells were homogenized in a RIPA buffer containing cOmplete Protease Inhibitor Cocktail and PhosphoSTOP Phosphate Inhibitor Cocktail Tablets (Roche, Indianapolis, IN, USA) using a Bead Ruptor 24 Elite bead mill homogenizer (Omni International ...
-
bioRxiv - Microbiology 2020Quote: ... the pelleted cells were re-suspended in 10 mM Tris pH 7.6 buffer containing cOmplete EDTA-free protease inhibitor cocktail (Roche Applied Sciences, Penzberg, Germany), sonicated ...
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates were extracted with phosphate-buffered saline (PBS) containing 2 % Triton X-100 and protease inhibitors (Roche Complete, Roche Diagnostics, Mannheim, Germany). Protein concentrations were determined by BCA-assay (Thermo Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The 500-bp dsDNA handle was the PCR product of a segment of pBluescript II KS using primers containing BfuAI and BSaI recognition sequences (forward primer: GCTGGGTCTCGTGGTTTCCCTTTAGTGAGGGTTAATTG; reverse primer: TATAGTCCTGTCGGGTTTCG) in the presence of Digoxigenin-11-dUTP (Roche; dTTP/dUTP = 4.5). The Digoxigenin-modified 500-bp handle DNA was digested to create the complementary overhang ...
-
bioRxiv - Cancer Biology 2022Quote: ... frozen human samples were disrupted in 600 µl of lysis buffer containing green ceramic beads using the MagNA Lyser Instrument (Roche Life Science, Germany). The cDNA synthesis was performed in a 20-µl reaction using random hexamers ...
-
bioRxiv - Bioengineering 2022Quote: ... and the cell pellet was re-suspended in 2 ml of triturating solution (containing 10 mg/ml bovine serum albumin [A7906, Sigma], 0.5 mg/ml trypsin inhibitor [10109886001, Roche], 0.02 mg/ml deoxyribonuclease).
-
bioRxiv - Genomics 2024Quote: ... Quantitative PCR was performed in a 20 μl reaction mixture containing 10 μl of FastStart Essential DNA Green Master (Roche Diagnostics, Mannheim, Germany), 8μl of 2.5 ng µl-1 cDNA ...
-
bioRxiv - Immunology 2024Quote: ... pipetting thymus fragments up and down to remove lymphocytes and then digesting the fragments with RPMI 1640 medium containing Liberase (Roche, 0.05 U/ml) plus DNase I (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: iAstrocytes were lysed for 15 min in ice-cold RIPA buffer containing PhosSTOP phosphatase inhibitors and protease inhibitors (Roche Life Science, Basel, Switzerland), sonicated ...
-
bioRxiv - Cell Biology 2020Quote: ... Japan) was employed for detection of proteins visualized by Lumi-light Plus Western blotting substrate (Roche, Basel, Switzerland).
-
Individual differences in honey bee behavior enabled by plasticity in brain gene regulatory networksbioRxiv - Genomics 2020Quote: ... with protein inhibitor complex (PIC, Complete Tablets, EDTA-free Protease Inhibitor Cocktail from Roche, Basel, Switzerland, cat. #04693132001) using a motorized pestle for 20 seconds ...
-
bioRxiv - Microbiology 2021Quote: ... Equivalent amounts of protein samples were separated by SDS-PAGE and electroblotted onto a polyvinylidene fluoride membrane (Roche) using a Mini Trans-Blot Cell (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... shTDP-43 HEK293E cell pellets from confluent 10cm plates were washed twice in ice-cold PBS and then resuspended in 500μl of hypotonic buffer A (10mM HEPES, 1.5mM MgCl2, 10mM KCl, 0.1mM DTT and protein inhibitor cocktail (Roche) and incubated on ice for 5 minutes ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 spike protein monoplex IHC was conducted using a Chromomap DAB IHC kit (Roche, Basel, Switzerland) with CC1 antigen retrieval at 95°C for 64 minutes ...
-
bioRxiv - Immunology 2020Quote: ... The TM protein was produced by transient transfection of HEK 293T cells with XtremeGene HP Transfection reagent (Roche) according to the manufacturer’s instructions and purified following a published protocol (48) ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was purified from filtered cell supernatants using StrepTactin resin (IBA) or cOmplete His-Tag Purification Resin (Roche) or Jacalin (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2021Quote: After being pre-cleared with protein A/G-coupled Sepharose beads (Cat. 11134515001 and 11243233001, Roche, Mannheim, Germany) for 2 hrs ...
-
bioRxiv - Microbiology 2021Quote: ... Separated proteins were transferred to PVDF membranes (GE Water & Process Technologies) and treated with Western blocking reagent (Roche) for overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... The protein was produced by transient transfection of HEK 293T cells with X-tremeGENE HP Transfection Reagent (Roche), according to the manufacturer’s instructions ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: For immunoblot analysis of proteins, tissues were homogenized in RIPA buffer (R0278, Thermo) with proteinase inhibitors (11836170001, Roche) and phosphatase inhibitors (04906837001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Two days after transfection cells were washed twice with ice-cold PBS and scraped in ice-cold Co-IP buffer (10 mM Tris/Cl pH 7.5, 150 mM NaCl, 0.5 mM EDTA, protein inhibitor cocktail (Roche)) supplemented with 0.5% Nonident P40 ...
-
bioRxiv - Neuroscience 2023Quote: ... Supernatants were pre-cleared by incubating with 30 μl of protein G-agarose beads suspension (Roche, cat. # 11719416001) for 3 h at 4°C on a mini-rotator ...
-
bioRxiv - Molecular Biology 2022Quote: ... the frozen brain samples were homogenized in tissue protein extraction reagent (Pierce) supplemented with complete protease inhibitors (Roche), and centrifuged for 1 hour at 430 000 g at 4 °C ...
-
bioRxiv - Pathology 2024Quote: Cholesterol and triglyceride levels were quantified in liver protein lysates and EDTA-plasma using enzymatic colorimetric assays (c.f.a.s. cobas, Roche Diagnostics) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: Protein extraction was performed using RIPA buffer in the presence of complete Mini EDTA-free protease inhibitor (Roche) and PhosSTOPTM phosphatase inhibitor (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Equal quantities of protein were electrophoresed on 10% SDS-PAGE and transferred onto a nitrocellulose membrane (Roche Diagnostics). The membranes were incubated with the primary antibody overnight at 4°C after blocking with 5% milk dissolved in TBST buffer for another 2 h at room temperature (25°C) ...