Labshake search
Citations for Roche :
2451 - 2500 of 2505 citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... RNA probes were in vitro transcribed from the linearized vector for 3 hours at 37°C with the corresponding RNA polymerase and DIG RNA Labeling Mix (Roche #11277073910). The reaction product was verified in 0,8% agarose gel and diluted in hybridization solution for further use ...
-
bioRxiv - Genomics 2024Quote: ... Samples were diluted in low-TE buffer and were subjected to 3 different miniaturized library prep methods: KAPA HyperPlus (Roche, KK8514), DNA Prep (Illumina ...
-
bioRxiv - Biochemistry 2023Quote: 106 cells were washed with 3 mL of cold PBS and resuspended in 50 µL solution containing 100 µg/mL neuraminidase from Clostridium perfringens (Roche, #11585886001). Cells were incubated for 1 h at 37 °C and washed twice with PBS before incubation with LiLA.
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with a panel of 3 reference genes (PUM1, RPL13A, ACTB) was performed using TaqMan qPCR chemistry on the Light Cycler 480 II (Roche Diagnostics). According to previously established methods 7 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Indexing PCRs were done with 3 cycles less than the determined qRT-PCR cycle threshold (Ct) using KAPA HiFi HotStart ReadyMix (KAPA Biosystems) with final custom Illumina I7 and I5 concentrations at 1 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gel plugs were incubated at 50°C for 3 days and treated with fresh proteinase K at 20 mg/ml concentration (Roche Diagnostics), every 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mM Tris pH 8, 3 mM MgCl2, 0.5% NP-40, 0.15 mM spermine, 0.5 mM spermidine, Roche EDTA-free protease inhibitor) and incubated on ice for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by cannulation of the trachea and gentle instillation/aspiration (3 times) of 1.0 ml of PBS with protease inhibitor cocktail tablets (Roche, Indianapolis, IN). The lavage fluid was centrifuged at 4000 rpm for 5 minutes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each eluate (3 µl) was subjected to PCR amplification in 50-μl reactions containing 1 KAPA HiFi HotStart Uracil+ReadyMix (Kapa Biosystems) and 0.3 μM Dual Index primers of NEBNext Multiplex Oligos for Illumina (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Genetics 2024Quote: ... cells were resuspended in 3 ml lysis buffer (PBS containing 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride and cOmplete proteinase inhibitor [Roche Diagnostics]), lysed by ultrasonic treatment and incubated with 1.2 ml NeutrAvidin Agarose for 0.5 h at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5% Normal Goat Serum) for 3 h at room temperature and then incubated overnight with alkaline phosphatase-conjugated anti-DIG Fab fragments (Roche, 1: 2,000) at 4°C on a shaking platform ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were lysed in 50 μl of Lysis Buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1x Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Developmental Biology 2021Quote: ... The DIG-labeled 3’UTR of Emi2 and cyclin B1 RNA probes were synthesized with a DIG-RNA-labeling kit (Roche Molecular Biochemicals). Two μg of probes was incubated with purified Flag-tagged proteins for 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... Tongues were removed and injected beneath the lingual epithelium with 0.2 mL enzyme solution (3 mg Dispase II, 0.7 mg collagenase B (Roche diagnostics, Indianapolis, IN, USA) and 1 mg Trypsin Inhibitor in 1mL Tyrode’s) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1996) on 16 µm cryosections at post-natal day 3 (P3) using anti-digoxigenin antibody (Sheep polyclonal, 1:1000, Roche, 11093274910, RRID:AB_514497). Two days exposure to alkaline phosphatase (AP ...
-
bioRxiv - Cancer Biology 2020Quote: ... N3500], 50 mM of Tris [pH 7.5], 150 mM of NaCl, 3 mM of MgCl2, 1X protease inhibitors [Roche, Mannheim, Germany; 05892953001]). Protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... a 6.7 kb DNA fragment starting 1 kb upstream of murine Gnrhr exon 3 was amplified by PCR using the Expand Long Template PCR System (Roche, Basel, Switzerland) from 129SvEv genomic DNA using primers incorporating 5’ XmaI and 3’ NotI restriction enzyme sites (Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... 45 cycles of 95°C for 3 s and 60°C for 30 s using the LightCycler 96 system (Roche, Basel, Switzerland) or the StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Genomics 2022Quote: ... Empty/filled PCRs (combining 5′ and 3′ flanking primers) and full-length PCRs (using junction-spanning primers) were performed using an Expand Long Range dNTPack (Roche, Cat#: 4829034001). Reaction mixes contained 5μL 5× Expand Long Range Buffer with 12.5mM MgCl2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... MA; N3500], 50mM of Tris [pH 7.5], 150 mM of NaCl, 3 mM of MgCl2, 1X protease inhibitors [Roche, Mannheim, Germany; 05892953001]). Protein concentration was measured using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were blocked for 1 h with 3% (w/v) non-fat milk powder in PBS/0.1% (v/v) Tween (PBST) (CALR, 10% Roche WBR in PBST) and incubated with primary antibody (Supplementary Table III ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Microbiology 2020Quote: ... and prepared for shotgun metagenomic sequencing using the Kapa Hyperprep Plus kit with 3 rounds of PCR amplification (Kapa Biosystems, Wilmington, MA), and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... qRT-PCR reactions were carried out in triplicates following a 3-step amplification protocol using the LightCycler 480 system (Roche Diagnostics, Switzerland). The ΔΔCT method [94] was used to calculate gene expression changes relative to housekeeping genes β-actin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 3 mM ATP, 10% sucrose and Roche protease inhibitors). For sS1 constructs ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 10% sucrose, 3 mM ATP, 1 mM DTT, 1 mM PMSF and Roche Protease Inhibitors), 1 ml per dish ...
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼0.5×106cells were collected and wash 3 times with Wash buffer (20 mM HEPES-KOH, pH 7.5,150mM NaCl, 0.5mM Spermidine, and Roche Complete Protease Inhibitor EDTA-free). Cells were captured with BioMagPlus Concanavalin A (Polysciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl, 10% sucrose, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 3 mM ATP, 1 mM PMSF and Roche protease inhibitors). Native mouse regulatory light chain (RLC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM β-mercaptoethanol (BME) and 0.3 μg/ml DNase I supplemented with 600 μl of protease inhibitor cocktail (Roche, Basel, Switzerland) and 5 mg lysostaphin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Immunology 2024Quote: ... tissue sections (n = 2-3 per tissue type) underwent deparaffinization and heat-mediated antigen retrieval on the Ventana Discovery Ultra auto-stainer platform (Roche Diagnostics, Canada), following the below instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reaction volumes were increased to 50 ul and 3 μl was subsequently used for qPCR reactions with SYBR Green (Roche, cat# 04887352001). Forward primers were designed at the 5’ ending of tRNAs and the reverse primers were designed against the 3’adapter while specificity was created against the 3’ endings ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...