Labshake search
Citations for Roche :
2201 - 2250 of 2505 citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection of 106 cells in a 6-well plate was performed using 5 μl of transfection agent (X-tremeGENE HP Reagent, Roche), 10 μL of bacmid and 85 μL of SF900II-SFM medium (Gibco) ...
-
bioRxiv - Microbiology 2023Quote: ... Then the different pellets were resuspended for 30 min in denaturing buffer (20 mM Tris, 500 mM NaCl, 6 M Guanidine, 20 mM Imidazole and protease inhibitor cocktail (Roche), pH 7.5) ...
-
bioRxiv - Cell Biology 2023Quote: ... D-glucose was measured spectrophotometrically3 by reading the increase in NADPH(H+) absorbance at 340 nm produced in two coupled reactions catalyzed by hexokinase and glucose-6-phosphate dehydrogenase (G6PD) (Roche diagnostics Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: For nuclear cell lysis 5×10^6 cells per condition were resuspended in 1mL of Lysis Buffer + protease inhibitor (cOmplete, Roche) (10mM Tris-HCl pH 7.4 ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded at 400,000 cells per well in 6-well plates and transfected the day after with indicated cDNA constructs with FuGENE6 (Roche). Reverse transfection of siRNAs was carried out using RNAiMAX according to the manufacturer’s instructions (Invitrogen Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells were seeded 72 hours prior to the experiment at 400,000 cells per well in 6-well plates and transfected the next day with wt or mutated myc-ALPK1 constructs with FuGENE6 (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Proteins were harvested from ∼30 mg of tissue (in vivo) or two 6-well plates (in vitro) and homogenised in Ripa buffer with complete mini-proteinase inhibitors (Roche). Preparation of nuclear and cytoplasmic extracts from human fibroblasts was performed using a NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were washed 6 times with MABT and were then incubated with anti-DIG AP-conjugated Fab fragment (Roche, 11093274910), Alexa-Fluor 488 goat anti-Mouse IgG1 antibody (ThermoFisher A-21121 ...
-
bioRxiv - Biochemistry 2023Quote: ... values of corresponding cDNAs with the QuantStudio 6 Pro system (Applied Biosciences, A43180) and FastStart Essential DNA Green Master (Roche) at a final concentration of 1X ...
-
bioRxiv - Cancer Biology 2023Quote: ... pUMVC for retrovirus) and 250 ng envelope vector (pCMV-VSV-G) are mixed with 20 µL Fugene 6 (Roche, USA) diluted in OptiMEM ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... Cells were then lysed by sonication 6 times for 15 sec each in one of the following buffers each containing the Protease Inhibitors Cocktail tablets (Roche) and 1 mg/mL lysozyme (L6876 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were amplified by ligation-mediated PCR for 6 cycles using a KAPA HiFi HotStart high-fidelity DNA polymerase (Roche) and purified using AMPure XP beads.
-
bioRxiv - Cell Biology 2024Quote: ... TNF and IL-6 were measured by flow cytometry and plasma glucose was measured with Accu-Chek Aviva Testrips (Roche).
-
bioRxiv - Molecular Biology 2024Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche), and the cells were fixed 5–6 days later ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Microbiology 2019Quote: ... frozen pellets were thawed and resuspended in 1 ml of 3 mg/ml lysozyme (Roche) and 0.4 mg/ml proteinase K (Ambion ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Genomics 2019Quote: ... beads were washed 3×1mL with bead wash buffer (1x PBS, 5mg/mL BSA, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 800 ng of plasmid vectors (50 ng / 750 ng or 200 ng / 600 ng of pAAV-Syn-eGFP-2A-mCherry_D4H/YDA or pAAV-Syn-Myr_mCherry-2A-eGFP and pAAV-iCre control respectively) using the FuGene6 transfection protocol (Roche, cat n°11 844 443 001) at a 3:1 DNA:FuGene ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% Triton X-100, 10 mM N-methyl maleimide (general DUB inhibitor diluted in DMSO, freshly added) and protease inhibitors (Roche Diagnostics, EDTA-free, freshly added). Then ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out in 12 μL volumes containing 6 μL of High Resolution Melting Master (Roche Applied Science, Germany), 0.24 μL of each 10 μM primer ...
-
bioRxiv - Cell Biology 2020Quote: C2 myoblasts were transfected 18-24 h after plating at 70-80% confluence by using FuGENE 6 (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Resulting cell pellets were resuspended in Buffer A (100 mM NaH2PO4, 10 mM Tris, 6 M GuHCl, 10 mM imidazole) + PIC (Roche 05056489001). Cells were sonicated 3X at 25% power for 10s (Cole-Parmer GE 130PB-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were added and after an additional 6 hours BrdU was added and a cell proliferation assay was performed according to the manufacturer’s instructions (Roche Applied Sciences).
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Microbiology 2022Quote: Mice were fasted for 6 h and baseline blood glucose levels were measured with an Accu-Check Performa blood glucose meter (Roche, USA) using blood collected from the tail vein ...
-
bioRxiv - Immunology 2019Quote: ... Each reaction consisted of a total amount of 12 µL divided into 6 µL LightCycler 480 SYBR Green I Master (Roche Diagnostics), 2 µL primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments were separated on 0.7% agarose gels buffered with 40 mM Tris-acetate at 4V/cm for 6 h and transferred overnight to nylon membranes (Roche, Switzerland) by alkaline transfer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 μl of the lysis buffer was added to each 6-well plate along with 1×Protease Inhibitor Cocktail (PIC, Roche cOmplete). The cells were incubated in a rocker at 4°C for 1hr ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.6 mL of incubation buffer (citric acid 100 mM and NaCl 250 mM pH 5.5 with inhibitor cocktail (Roche, Rotkreuz, Switzerland) dilution according to the instructions of the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...