Labshake search
Citations for Roche :
2051 - 2100 of 2505 citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AGCGTTCACATCATATGGCA-3’) using Taq DNA polymerase (Roche, Cat. No. 11146165001). Fragments of foxl2l and id1 were cloned into pGEMT-easy plasmid by TA cloning while nanos2 fragment was cloned into pCS2+ plasmid by BamHI and KpnI ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Cell Biology 2020Quote: Cells were pelleted and lysed with 1.5% n-dodecyl-D-maltoside (DDM) in PBS with cOmplete™ protease inhibitor (Roche) for 15 min on ice ...
-
bioRxiv - Genetics 2021Quote: ... and Tvrm323 mice (n = 4) eyes at one month of age were dissected in ice- cold PBS with proteinase inhibitor (Roche) and snap frozen in eppendorf tubes on dry ice.
-
bioRxiv - Cell Biology 2019Quote: ... ground yeast powder was solubilized in 4 volumes of homogenization buffer (400 mM trisodium citrate, pH 8, 0.5% n-Dodecyl β-D-maltoside) and protease inhibitor cocktail (Roche). The soluble fraction was incubated with 10 μl magnetic beads (Dynabeads ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Immunology 2020Quote: ... The treated samples were purified using a C18 cartridge (Oasis HLB Plus Waters) prior to the release of N-glycans by PNGase F (recombinant from Escherichia coli, Roche) digestion ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then washed with PBS and lysed in HEPES buffer supplemented 100 μM N-ethylmaleimide and protease inhibitor cocktail (Roche). The lysates were centrifuged and incubated with 2 μg Mcl-1 antibody (S-19 ...
-
bioRxiv - Immunology 2022Quote: ... and 11-week infected half brains and liver lobes of mice (n=4/group) was extracted and purified using a High Pure PCR Template Prep Kit (Roche). DNA concentration of each sample was determined via NanoDrop ...
-
bioRxiv - Developmental Biology 2024Quote: ... were pre-washed in 0.25%BSA/DPBS and resuspended in 1ml of L3 sonication buffer (10mM TrisCl pH 8.0, 100mM NaCl, 1mM EDTA, 0.5mM EGTA, 0.1% Na-Deoxycholate, 0.5% N-Laroylsarcosine, filtered and with Roche Protease Inhibitor #04693159001) with 1% Triton ...
-
bioRxiv - Biochemistry 2023Quote: ... or HT alone and 0.001 μg/well N-terminally NL-tagged CCT5 and MAGEA3 (FL or -EE degrons) using X-tremeGene HP transfection reagent (Roche), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RPE1 cells were transfected with PB-Tet-LAP-MAP3K1 and PB-Transposase plasmid (kindly provided by N. Dimitrova) using X-tremeGENE9 reagent (Roche) and after 48 hours cells were selected with G418 ...
-
bioRxiv - Neuroscience 2024Quote: ... and stressed (n=4) DA neurons to prepare stranded RNAseq libraries following manufacturer’s recommendations using KAPA mRNA hyperprep (Roche Diagnostic). Each final library was quantified and qualified with 2200 Tapestation (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant RBD007 plasmid was transfected using FuGENE 6 transfection reagents (Roche Applied Science, Indianapolis, IN) into CHO-K1 cells precultured in F-12K medium (American Type Culture Collection ...
-
bioRxiv - Immunology 2021Quote: ... Th17-cell differentiation was induced using a cytokine cocktail of IL-6 (20 ng/mL; Roche), IL-1β (10 ng/mL ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were PCR amplified with KAPA HiFi for 4-6 cycles (KAPA Biosystems, Boston, MA). The final libraries were purified with two 0.7x AMPureXP bead cleanups ...
-
bioRxiv - Cell Biology 2020Quote: ... Gag/Pol and VSV-G using Fugene-6 transfection reagent as per the manufacturer’s instructions (Roche) for 8 hours ...
-
bioRxiv - Developmental Biology 2020Quote: Separate PLAT-E cultures were transfected with 9µg of each pMX plasmid using FuGENE 6 (Roche) for retroviral production ...
-
bioRxiv - Immunology 2021Quote: ... in the absence (Th0) or presence (Th17) of IL-6 (20ng/ml, Roche, Cat# 11138600 001); IL-1β (10ng/ml ...
-
bioRxiv - Immunology 2021Quote: ... Th17 cell polarization was induced using a cytokine cocktail of IL-6 (20 ng/mL; Roche), IL-1β (10 ng/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots (6 μL) of tg7-brain homogenates were supplemented with a mixture of protease inhibitors (Roche), mixed with 5% glucose (94 μL ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Wings were stained at room temperature for 4-6 h in BM Purple (Roche Applied Science).
-
bioRxiv - Neuroscience 2023Quote: ... Protein lysates were prepared from zebrafish larvae (6 dpf) in RIPA buffer containing protease inhibitors (Roche), using a manual dounce homogenizer ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 tetrazolium]-bis(4-methoxy-6-nitro)-benzene sulfonic acid hydrate (XTT)-based colorimetric assay (Roche) according to manufacturer-recommended protocols ...
-
bioRxiv - Cell Biology 2019Quote: ... hypervirulent M.tb infected and uninfected macrophages using calibrated normalised relative quantities using the equation N = N0 x 2Cp (LightCycler®96 software, Roche). All qPCRs were done on RNA extracted from three separate experiments ...
-
bioRxiv - Developmental Biology 2021Quote: ... FISH signal was developed with tyramide reaction following O/N incubation of embryos in sheep anti-DIG antibody (Roche; Cat#11222089001) (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2023Quote: ... total RNA (50 μg) was separated on 1% agarose–formaldehyde gels and transferred to Hybond-N+ nylon membranes (Roche, Basel, Switzerland). Northern blotting was conducted with biotin-labeled DNA (bio-CTGTAGAAAGTCTGCTGATCGATACCGCGACG ...
-
bioRxiv - Cell Biology 2023Quote: ... N-glycans were released directly using cartilage lysates following deglycosylation by overnight treatment with peptide N-glycanase F (PNGase F, 2U) (Roche, Switzerland). The supernatants containing GSLs and fOSs were dried with a centrifugal evaporator ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 μM ATP and supplemented with 1× phosphatase inhibitors cocktail 3 (Roche). Reactions were carried out at 30°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... blocked in 3% BSA and probed with anti-HA (clone 12CA5, Roche), anti-cMyc (clone 9E10 ...
-
bioRxiv - Neuroscience 2020Quote: ... Following resuspension in (3 ml) homogenization medium containing protease inhibitor (Roche Diagnostics), the cells were cracked open using a ball bearing homogenizer with a 0.2507-inch bore and 0.2496-inch diameter ball ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Blocking was then performed with DBPS containing 3% BSA (Roche, Cat#3116956001) and 1% Chicken serum (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... 1/3 of a Complete EDTA-free protease inhibitor cocktail tablet (Roche) and were lysed by five passes through an Avestin C3 homogenizer at 15-20,000 PSI ...
-
bioRxiv - Cell Biology 2020Quote: ... The cartilage was then incubated in 3 mg/mL Collagenase D (Roche) in DMEM solution for two 45 minute periods and transferred to 0.5 mg/mL Collagenase D in DMEM solution supplemented with 3% Liberase TL (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nuclei lysates (in Nuclear Buffer Lysis 3, supplemented with protease (Roche, 11697498001) and phosphatase inhibitors (1 mM Na3O4V (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... Beads were washed 3 times with lysis buffer containing proteinase inhibitors (Roche) and 7 times with lysis buffer without proteinase inhibitors ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3 µl 10 mM dNTP (KAPA HiFi Kits from Roche, KK2502) were added to the annealed oligos ...
-
bioRxiv - Immunology 2022Quote: ... and pLenti-Luc-GFP (6 µg) into HEK293T cells using X tremeGENE HP DNA Transfection Reagent (Roche) according to the manufacturer′s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... The Th17 cultured cells were stimulated in presence of IL-6 (20ng/ml, Roche, Cat# 11138600 001); IL-1β (10ng/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were transfected with a total of 1 µg of DNA using Fugene 6 (Roche, Branchburg, NJ) according to the manufacturer’s instructions
-
bioRxiv - Immunology 2020Quote: ... brains were cut into 6 pieces and incubated in 5 mL HBSS containing 50U/mL DNase (Roche), and 4U/mL papain (Worthington-Biochem ...
-
bioRxiv - Neuroscience 2021Quote: ... Vector DNA was transiently transfected into human embryonic kidney (HEK) cells using Fugene-6 (Roche Molecular Biochemicals) transfection reagent ...
-
bioRxiv - Immunology 2023Quote: ... Serum IL-6 and CRP levels were measured using in vitro diagnostic methods validated at PPD (Roche Cobas ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Tissues were homogenized in 1 ml N-PER (brain) or T-PER (other organs) + Complete Mini protease inhibitor cocktail tablet (Roche, Mannheim, Germany) in FastPrep Lysing Matrix D tubes on a FastPrep homogenizer ...
-
bioRxiv - Molecular Biology 2021Quote: ... were transiently transfected for 24 h with 9,36 μg of hNAA40-flag expression vectors and using 35 μl Fugene HD (Roche, cat. n°04709705001) according to the manufacturer’s instructions ...