Labshake search
Citations for Roche :
2101 - 2150 of 2392 citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... Cells were then lysed by sonication 6 times for 15 sec each in one of the following buffers each containing the Protease Inhibitors Cocktail tablets (Roche) and 1 mg/mL lysozyme (L6876 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were amplified by ligation-mediated PCR for 6 cycles using a KAPA HiFi HotStart high-fidelity DNA polymerase (Roche) and purified using AMPure XP beads.
-
bioRxiv - Neuroscience 2024Quote: ... proteins were extracted by resuspending cells from 6-well plates in 100 μl of RIPA or 7M Urea Buffer containing protease inhibitor (11873580001, Roche) and ...
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche) and cells were fixed 5–6 days later ...
-
bioRxiv - Microbiology 2024Quote: ... Typhi harboring the different transcriptional reporters were grown at 37 °C in LB supplemented with glucose-6-phosphate (G6P) (Roche) (concentrations ranging from 7.6 μM to 10 mM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ovaries were cut into 6-8 pieces and enzymatically digested in L-15 media containing Liberase TM (Roche, Indianapolis, IN) and DNase I (Worthington Biochemicals ...
-
bioRxiv - Cancer Biology 2024Quote: ... PDOs were pooled from 6 wells and incubated for 1.5 hours on ice in Cell Recovery Buffer supplemented with phosphatase inhibitors (Roche, 4906845001). PDOs were lysed using RIPA buffer (Boston BioProducts ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection of 106 cells in a 6-well plate was performed using 5 μl of transfection agent (X-tremeGENE HP Reagent, Roche), 10 μL of bacmid and 85 μL of SF900II-SFM medium (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Microbiology 2019Quote: ... frozen pellets were thawed and resuspended in 1 ml of 3 mg/ml lysozyme (Roche) and 0.4 mg/ml proteinase K (Ambion ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Genomics 2019Quote: ... beads were washed 3×1mL with bead wash buffer (1x PBS, 5mg/mL BSA, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 800 ng of plasmid vectors (50 ng / 750 ng or 200 ng / 600 ng of pAAV-Syn-eGFP-2A-mCherry_D4H/YDA or pAAV-Syn-Myr_mCherry-2A-eGFP and pAAV-iCre control respectively) using the FuGene6 transfection protocol (Roche, cat n°11 844 443 001) at a 3:1 DNA:FuGene ratio ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% Triton X-100, 10 mM N-methyl maleimide (general DUB inhibitor diluted in DMSO, freshly added) and protease inhibitors (Roche Diagnostics, EDTA-free, freshly added). Then ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplification was carried out in 12 μL volumes containing 6 μL of High Resolution Melting Master (Roche Applied Science, Germany), 0.24 μL of each 10 μM primer ...
-
bioRxiv - Cell Biology 2020Quote: C2 myoblasts were transfected 18-24 h after plating at 70-80% confluence by using FuGENE 6 (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Resulting cell pellets were resuspended in Buffer A (100 mM NaH2PO4, 10 mM Tris, 6 M GuHCl, 10 mM imidazole) + PIC (Roche 05056489001). Cells were sonicated 3X at 25% power for 10s (Cole-Parmer GE 130PB-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... were added and after an additional 6 hours BrdU was added and a cell proliferation assay was performed according to the manufacturer’s instructions (Roche Applied Sciences).
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... cells transfected with a combination of RCAS plasmids (RCAS PDGFB-HA, RCAS shp53-RFP) using the FuGENE 6 transfection kit (Roche, 11814443001) according to the manufacturer’s protocol and as previously described 86 ...
-
bioRxiv - Microbiology 2022Quote: Mice were fasted for 6 h and baseline blood glucose levels were measured with an Accu-Check Performa blood glucose meter (Roche, USA) using blood collected from the tail vein ...
-
bioRxiv - Immunology 2019Quote: ... Each reaction consisted of a total amount of 12 µL divided into 6 µL LightCycler 480 SYBR Green I Master (Roche Diagnostics), 2 µL primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments were separated on 0.7% agarose gels buffered with 40 mM Tris-acetate at 4V/cm for 6 h and transferred overnight to nylon membranes (Roche, Switzerland) by alkaline transfer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 μl of the lysis buffer was added to each 6-well plate along with 1×Protease Inhibitor Cocktail (PIC, Roche cOmplete). The cells were incubated in a rocker at 4°C for 1hr ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.6 mL of incubation buffer (citric acid 100 mM and NaCl 250 mM pH 5.5 with inhibitor cocktail (Roche, Rotkreuz, Switzerland) dilution according to the instructions of the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...