Labshake search
Citations for Roche :
201 - 250 of 5652 citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity assays were performed as described29 (with minor changes. Proliferation of human cells was assessed using an MTT colorimetric assay (Cell Proliferation Kit I, Roche). HeLa (epithelial cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Cancer Biology 2022Quote: The BrdU assay was performed using the Cell Proliferation ELISA BrdU assay (Roche #11647229001) according to manufacturer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cellular proliferation was assessed with the BrdU cell proliferation ELISA (11647229001, Roche, Basel, Switzerland). In brief ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Roche Cat#11691112001) was purchased from Sigma (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 g/ml human transferrin (Roche), 5 ng/ml VEGF (PeproTech 450-32) ...
-
bioRxiv - Immunology 2022Quote: ... recombinant human IFNγ from Roche (#11040596001), recombinant human IL-1β from PeproTech (#200-01B).
-
bioRxiv - Cancer Biology 2020Quote: ... 180 μg/ml human transferrin (Roche). Flk-1+ cells were isolated by magnetic cell sorting (MACS ...
-
bioRxiv - Developmental Biology 2021Quote: ... F0425)/500 µg protein with protein A-agarose (Roche). Fished-out FGFR3 protein was eluted and then denatured at 95°C for 10 minutes in NuPAGE LDS sample buffer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 0.25 μM gene-specific primers and 5 μl LightCycler 480 SYBR Green I Master (Roche) on a Roche LightCycler 480 II real-time PCR System according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... MpC1HDZ was amplified from cDNA using a specific forward primer and polyT reverse primer (Roche) and ligated into pGEMT ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). Cq values of non-housekeeping genes were normalized to RHOA or b-ACTIN expression ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates sampled with phospho-specific antibodies were also lysed with phosphatase inhibitors (phosSTOP™, Roche). Lysates were then centrifuged at 20,000 g ...
-
bioRxiv - Immunology 2022Quote: ... 200 nM specific TaqMan probe (TM) and the LightCycler® Multiplex RNAVirus Master mix (ROCHE). The programs were ...
-
bioRxiv - Genomics 2022Quote: ... to assess their size distribution and quantified by qPCR with adapter-specific primers (Kapa Biosystems). Libraries were pooled together based on expected final coverage and sequenced across multiple flow cell lanes to reduce the effect of lane-to-lane variations in yield ...
-
bioRxiv - Immunology 2019Quote: ... Gene-specific oligonucleotides (Supplementary Table I) were designed using the Universal ProbeLibrary software (Roche Diagnostics). Results were expressed relative to the expression level of the endogenous reference gene TBP and using the ΔΔCT (cycle threshold ...
-
bioRxiv - Systems Biology 2020Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche, 06402712001). RHOA expression was used as a housekeeping gene for the normalization of non-housekeeping gene expression ...
-
bioRxiv - Immunology 2020Quote: ... using V gene-specific primers 18 and KAPA Biosystems (KAPA HiFi HotStart, Roche, Basel, Switzerland). The PCR conditions were as follows ...
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Biophysics 2023Quote: ... gene-specific oligonucleotides (Supplementary Table 14) and analyzed using the LightCycler480™ system (Roche Diagnostics). We calculated mRNA expression levels relative to the housekeeping gene Hypoxanthine Phosphoribosyltransferase 1 (HPRT).
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was amplified using gene-specific primers and FastStart Essential DNA Green Master (Roche #06402712001). Cq values of genes of interest were normalized to housekeeping gene RHOA expression.
-
bioRxiv - Biochemistry 2019Quote: ... Blocking reagent for ELISA (BRE) and cOmplete protease inhibitor tablets were from Roche (Basel, Switzerland). Phosphate buffered saline (PBS ...
-
bioRxiv - Genomics 2021Quote: ... 100uL of the clarified supernatant was used in the anti-BrdU DNA fragmentation ELISA (Roche). Each condition was tested in technical triplicates ...
-
bioRxiv - Cell Biology 2022Quote: ... BrdU incorporation was carried out according to the manufacturer′s specifications (Cell Proliferation ELISA, Roche) with an incubation time of 5 hours as previously described.23 Quantification was performed by measuring the absorbance using Power Wave 340 ELISA reader from Bio-Tek.
-
bioRxiv - Cell Biology 2020Quote: Cells were lysed and proteins were purified by Complete™ Lysis-M EDTA-free kit (Roche, 04719964001). Protein samples were run on Mini-PROTEAN® TGX™ Precast Gels (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... Serial dilutions of human genomic DNA (Roche) (final concentrations from 0.5 ng/mL to 5000 ng/mL ...
-
bioRxiv - Immunology 2021Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... Human IL-2 (TECIN™ teceleukin, ROCHE, was generously provided by the NCI Biological Resources Branch ...
-
bioRxiv - Molecular Biology 2021Quote: ... and human genomic DNA (Roche Diagnostics, Germany) were used as templates for the experiments in Figure 2 and S1a ...
-
bioRxiv - Immunology 2023Quote: ... 100 U/mL human IL-2 (Roche), 50 ng/mL human IL-21 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and anti-CD20 human Ab (obinutuzumab, Roche). Relevant negative controls were performed using isotype antibodies and cells incubated with anti-CD20 human and anti-CD20 mouse antibody served as a positive control ...
-
bioRxiv - Plant Biology 2019Quote: The satellite-specific probes were labelled by PCR in the presence of biotin-16-dUTP (Roche). We used nick translation to mark the probes for the ribosomal genes ...
-
bioRxiv - Neuroscience 2020Quote: ... we used gene-specific primers and Light Cycler® 480 SYBR Green I Master (Roche Diagnostics). Polymerase chain reaction conditions were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa cells were transfected with Lpd-specific or scramble shRNA as control using Fugene HD (Roche) transfection reagent ...
-
bioRxiv - Plant Biology 2019Quote: ... using gene-specific digoxigenin-nucleotide-labelled DNA probes (Digoxigenin-11-dUTP alkali-labile, Roche, Basel, Switzerland) obtained using the same primer pairs and conditions as for the PCR ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time amplification was carried out using gene-specific primers and SYBR Green Master mix (Roche) on a Lightcycler LC480 apparatus (Roche ...
-
bioRxiv - Synthetic Biology 2020Quote: ... specific mutations were introduced to the DNA polymerase gene by site-directed mutagenesis (Roche Sequencing Solutions) to enhance the kinetic properties of the polymerase utilizing polynucleotide tagged nucleotides to approach native nucleotide incorporation characteristics32 ...
-
bioRxiv - Physiology 2020Quote: ... Eluted DNA was amplified with specific primers (Table S2) using SYBR Green Master (Roche, Basel, Switzerland), and the resulting signals were normalized to input activity.
-
bioRxiv - Molecular Biology 2022Quote: ... One set specific to the GFP region includes the Universal probe library (UPL) probe #67 (Roche), the forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... qRT-PCR was performed using specific primers and the LightCycler 480 SYBR Green I (#04887352001, Roche) on a LightCycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed with specific primers (Table S2) and LightCycler 480 SYBR Green I Mastermix (Roche) using the LightCycler 480 II real-time PCR device (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Duplicates of cDNA samples and specific primers were mixed with Lightcycler SYBR Green I Master (Roche). Reactions were carried out on a Lightcycler 480 Instrument II (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... Enrichment of the specific histone mark was quantified by qPCR using SYBR Green Master Mix (Roche) and qPCR primers 1.4 kb away from the DSB (3xp3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Duplicates of cDNA samples and specific primers were mixed with Lightcycler SYBR Green I Master (Roche). Reactions were carried out on a Lightcycler 480 Instrument II (Roche).
-
bioRxiv - Microbiology 2024Quote: ... interleukin-2 (IL-2; specific activity 10 U/ng) at concentration of 20 ng/mL (Roche) and phytohemagglutinin (PHA ...