Labshake search
Citations for Roche :
51 - 100 of 5652 citations for Human Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... BrdU incorporation was measured using the Cell Proliferation ELISA kit (Roche #11-669-915-001) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... CAT expression was determined using an ELISA kit in accordance with the manufacturer’s instructions (Roche). Bovine IFN-α standards were used to construct a type I IFN standard curve to interpolate sera sample IFN levels.
-
bioRxiv - Biochemistry 2023Quote: DNA synthesis or replication was monitored by measuring the Cell Proliferation ELISA BrdU kit (Roche). Cells were cultured on a Nunc 96-well plate (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Transcript levels were determined by LightCycler 480 Real-Time PCR System from Roche, using SYBR green I Master from the same company ...
-
bioRxiv - Immunology 2023Quote: ... Transcripts were quantified by real time PCR on a 480 LightCycler instrument (Roche). Reactions were carried out in 10μL ...
-
bioRxiv - Plant Biology 2024Quote: ... Accumulation of transcripts was measured by qRT-PCR (LightCycler 480, Roche Diagnostics, USA) using the SYBR Premix Ex TaqTM (TaKaRa ...
-
bioRxiv - Immunology 2022Quote: ... measured by RT ELISA (Roche), per well (MOI 0.2 ...
-
bioRxiv - Genomics 2023Quote: ... ELISA BrdU Colorimetric assay (Roche) was performed according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... of total and polysomal transcripts was conducted as described in [96] with the difference of using KAPA SYBR® FAST qPCR Kit (Kapa Biosystems, South Africa). ACTIN2 (AT3G18780 ...
-
bioRxiv - Plant Biology 2022Quote: ... gene-specific cDNA was amplified and labeled using the DIG RNA Labeling Kit (Roche, Basel, Switzerland). Pretreatment of sections ...
-
bioRxiv - Systems Biology 2024Quote: ... strand-specific RNA-seq library was built with the KAPA RNA Hyper Prep kit (Kapa Biosystems) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The AAV2 ITR specific probe was labeled using the DIG DNA labeling kit (11175033910, Roche, Switzerland) using the following oligonucleotide ...
-
bioRxiv - Cell Biology 2021Quote: Cell death (apoptosis) was measured using the Cell Death Detection ELISA kit (Roche Diagnostics, Madrid, Spain) while mitochondrial metabolism was assessed using the MTT assay ...
-
bioRxiv - Physiology 2021Quote: Cell death (apoptosis) was measured using the Cell Death Detection ELISA kit (Roche Diagnostics, Madrid, Spain) as previously described 26.
-
bioRxiv - Cancer Biology 2021Quote: ... Proliferation of cultured cells was measured by assessing BrdU incorporation (Cell proliferation ELISA Kit 11647229001; Roche) after addition of Dox (2µg/ml ...
-
bioRxiv - Immunology 2020Quote: Telomerase activity was assessed with a TeloTAGGG telomerase ELISA kit according to the manufacturer’s instructions (Roche) and extracts of 2 × 103 viable T cells as described previously27.
-
bioRxiv - Molecular Biology 2022Quote: ... DNA fragmentation was evaluated using a Cellular DNA Fragmentation ELISA Kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... Transcript from 15ng cDNA was quantitated with LightCycler 480 SYBR Green I (Roche, 04887352001) using the Roche LightCycler 480 II machine ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression levels of individual transcripts were determined by quantitative PCR using SYBR Green (Roche) for detection ...
-
bioRxiv - Plant Biology 2022Quote: Transcript levels were assessed by quantitative RT-PCR using a LightCycler 480 system (Roche), as described by Gutierrez et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... The transcripts were quantified using Light Cycler 480Real-Time PCR system (Roche, Basel, Switzerland). Primers were designed using Primer Quest (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... and library specific qPCR (KAPA biosystems). Libraries were then diluted to 17pM per manufacturer’s recommendation and sequenced using version 3 paired-end (2×300bp length ...
-
bioRxiv - Molecular Biology 2021Quote: ... PAN specific oligonucleotide probes were labeled with a DIG-Oligonucleotide tailing kit (Sigma Roche 2nd generation 03353583910) and mixed at the 1:1:1 ratio ...
-
bioRxiv - Physiology 2020Quote: ... Strand-specific sequencing libraries were prepared using the KAPA mRNA Hyper Prep kit (Roche Sequencing, Pleasanton, CA). Libraries were sequenced on Illumina NovaSeq sequencer in the 100 bp paired-end sequencing mode according to manufacturer’s protocols with multiple samples pooled per lane ...
-
bioRxiv - Cell Biology 2023Quote: ... Strand specific RNA sequencing (RNA-seq) libraries were generated using the KAPA Stranded RNA-Seq kit (Roche) and were amplified for 5 PCR cycles (45 s at 98 °C for initial denaturing and cycles of 15 s at 98 °C ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were stained with Bromodeoxyuridine (BrdU) and assessed with a BrdU ELISA kit (Roche, Mississauga, ON, Canada) following the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2021Quote: ... Gene transcript abundance was quantified by RT-qPCR using FastStart Essential DNA Green Master (Roche) on a Lightcycler 96 (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: Transcript levels were determined by quantitative real-time PCR on a LightCycler 480 system (Roche) using SYBR Green I Master Mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... Amplification of bulk IFN-α transcripts was detected using Universal Probe Library probe #76 (Roche) with forward primer ARSYtgtStgatgcaRcaggt and reverse primer ggWacacagtgatcctgtgg ...
-
bioRxiv - Plant Biology 2019Quote: ... Transcript levels were measured by qRT-PCR using LightCycler 480 SYBR Green I Master (Roche) and a LightCycler 96 (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... Differentially expressed transcripts were analyzed with SYBR Green Mix (Roche FastStart Universal SYBR Green Master) and specific primers (Supplementary Table S2) ...
-
bioRxiv - Immunology 2023Quote: ... VH and VL-only transcripts were amplified using the FastStart High Fidelity PCR System (Roche) with gene-specific primers (123) ...
-
bioRxiv - Plant Biology 2022Quote: ... Specific DNA probes for hpt and OsSOG1 were synthesized with a PCR Digoxigenin Probe Synthesis Kit (Roche Diagnostics) using the primers shown in Table S7.
-
bioRxiv - Genomics 2020Quote: ... targeting the nCoV2 specific ORF1ab (RdRp) and pan-sarbeco specific E genes on LightCycler® 480 System (Roche) and ABI 7500 Fast DX (Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: Transcript levels were assessed by quantitative RT-PCR using a Light Cycler® 480 System (ROCHE), as previously described by (Gutierrez et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... BrdU Cell Proliferation ELISA assay (Roche, 11647229001) was used to assess the proliferation of RKO and DLD1 cells according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pax3 digoxigenin (DIG) - labeled antisense riboprobes were transcribed from linearized gene-specific probes (PCR DIG probe Synthesis Kit, Roche). WISH experiment was performed as follows ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Bioengineering 2023Quote: ... of the VH gene was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene-specific primers (primer No. 23–32, 7.5 μl) and a KAPA Biosystems kit (Roche). The reaction conditions were as follows ...
-
bioRxiv - Cancer Biology 2019Quote: BSA Protein Assay Kit (A8020-5, Roche, Basel, Switzerland) was applied to measure the protein concentration after lysing BC cells with RIPA buffer ...
-
bioRxiv - Immunology 2020Quote: ... Parasite cultures were confirmed to be free of mycoplasma and acholeplasma using an ELISA-based Mycoplasma Detection Kit (Roche) which contains polyclonal antibodies specific for M ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Developmental Biology 2021Quote: ... Signals of transcripts were detected using Anti-DIG-AP (alkaline phosphatase) and Fab fragments from sheep (Roche) and developed in Fast Red TR and naphthol-AS-MX-phosphate in 0.1 M Tris-HCl pH 8.2 (tablet set ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts were quantified by using LightCycler® 480 SYBR Green I Master Mix (Roche, Cat. N: 04707516001) with the appropriate primers (see key resource table ...
-
bioRxiv - Microbiology 2020Quote: ... A GFP-specific monoclonal antibody (mAb) 11814460001 (Roche) was used at 1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and specific primers on a LightCycler 480 (Roche). The reactions were performed in triplicates ...
-
bioRxiv - Cancer Biology 2022Quote: ... and specific primers on the LightCycler 96 (Roche). Relative target gene expression was determined by comparing average threshold cycles (CT ...
-
bioRxiv - Microbiology 2022Quote: ... the non-specific competitor Poly dI dC (Roche) was added to each reaction before the probe at a final concentration of 2.5 ng/µl (52) ...
-
bioRxiv - Microbiology 2023Quote: ... the non-specific competitor poly-dI-dC (Roche) was added to the EMSA reactions at a final concentration of 2.5 ng/µL ...