Labshake search
Citations for Roche :
2301 - 2350 of 3852 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Real-time PCR was performed using FastStart Universal SYBR Green Master (Rox) (Roche) and LightCycler384 (Roche) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and quantitative PCR was performed with technical triplicate using SYBR green reagent (Roche) on a ViiA7 equipment (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR system (20 μL in total) contained 2×SYBR Green Mix (Roche) 10 μL ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... KAPA Taq PCR kit was used according to the manufacturer’s protocol (Kapa Biosystems).
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... and analyzed on a real-time PCR instrument (LightCycler 480, Roche Molecular Systems) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... All PCR reactions were performed using the KAPA HiFi DNA Polymerase (Roche # 07958846001) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... 500 µM PCR Nucleotide Mix (dATP, dCTP, dGTP, dTTP at 10 mM, Roche), 0.3 µM of each primer ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative real time PCR was performed on Light Cycler 480 II instrument (Roche) using Power SYBR™ Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative real-time PCR was performed on the cDNA using an LC480 (Roche) and the SYBR green assay ...
-
bioRxiv - Pathology 2020Quote: ... The samples were run on a LightCycler480 real-time PCR thermal cycler (Roche), and the relative ratio of the expression of each gene was calculated using the 2ΔΔCt method ...
-
bioRxiv - Neuroscience 2019Quote: ... in a real-time quantitative PCR (qPCR) detection system (LC480, Roche, Basel, Switzerland) using the following primers ...
-
bioRxiv - Genetics 2019Quote: ... the supernatant was subjected to real-time quantitative PCR with Lightcycler 480 (Roche). The primers for LEU3 on the genome or leu2d gene on pTOW40836 and SYBR Green I Master (Roche ...
-
bioRxiv - Developmental Biology 2019Quote: ... and subjected to real-time PCR analysis in a LightCycler 480 instrument (Roche) with Thunderbird SYBR qPCR Mix (Toyobo) ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR reactions were performed with LightCycler 480 SYBR Green I MasterMix (Roche) in a LightCycler480II instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... bead-captured RNAs were digested with 100 ng Proteinase K (PCR grade, Roche) and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... 1X PCR Master Mix (FastStart Universal SYBR Green Master Rox, Roche, Mannhein, Germany) and 1 μl of cDNA in a final volume of 20 μl.
-
bioRxiv - Cancer Biology 2019Quote: ... Cp values were measured using a LightCycler 480 Real-Time PCR System (Roche). Relative fold-change in expression values were calculated using the following formula ...
-
bioRxiv - Genetics 2020Quote: ... or ear notch biopsies using the High Pure PCR Template Preparation Kit (Roche), KAPA Express Extract kit (Roche) ...
-
bioRxiv - Physiology 2020Quote: ... in triplicates using LightCycler 480 Real-Time PCR System (Roche Diagnostics, Mannheim, Germany). All genes were normalized to β-actin ...
-
bioRxiv - Neuroscience 2020Quote: ... qPCR was perfomed using a LightCycler® 480 Real-Time PCR System (Roche). qPCR reactions were done in duplicate for each sample ...
-
bioRxiv - Biochemistry 2021Quote: ... and qRT-PCR was performed using FastStart universal SYBR green master mix (Roche). RPL19 mRNA was used as loading control.
-
bioRxiv - Molecular Biology 2019Quote: ... and purified using a high pure PCR product purification kit (Roche, No. 11732668001). The DNA blots were prehybridized at 42°C for 1 h in DIG easy hyb granule and then hybridized to denatured DIG-labeled probes for 20 h ...
-
bioRxiv - Cell Biology 2021Quote: ... qChIPs were analysed by real-time PCR using Lightcycler 480 SYBR Green (Roche) Oligonucleotides are listed in Supp ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative PCR was performed using a LightCycler 480 instrument (Roche Diagnostics, Rotkreuz, Switzerland) and TaqMan methodology with a fluorescent PCR probe (FAM-NFQ/MGB ...
-
bioRxiv - Immunology 2020Quote: ... Site-directed mutagenesis was performed using the KAPA Hifi PCR kits (KAPA Biosystems).
-
bioRxiv - Microbiology 2020Quote: ... The PCR was performed on a LightCycler 480 (Roche Life Sciences, Mannheim, Germany) using the following conditions ...
-
bioRxiv - Immunology 2020Quote: ... Amplification by PCR was performed on a LightCycler instrument (Roche, Almere, the Netherlands), with software version 3.5 ...
-
bioRxiv - Immunology 2020Quote: ... was used for real-time PCR with a LightCycler® 480 system (Roche). The following primers were used for the assay ...
-
bioRxiv - Microbiology 2021Quote: ... DNA sequencing libraries were prepared using the PCR-free KAPA HyperPrep Kit (Roche). Libraries were sequenced on an Illumina NextSeq 500 and the quality of the raw sequencing reads was analysed with FastQC (version 0.11.4 ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR assays were performed using the FastStart SYBR Green Master Mix (Roche) on a Step One Plus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Genetics 2019Quote: qChIPs were analysed by real-time PCR using Lightcycler 480 SYBR Green (Roche) with oligonucleotides listed in Supplementary Information Table S3 ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... and quantified by real-time PCR using the KAPA Library Quantification kit (Roche) with the QuantStudio-7flex Real-Time PCR system (Thermo) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gel purified PCR products (200ng) are purified and used in T7 (Roche 10881775001) in vitro transcription reaction ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were carried out on a LightCycler 480 Real-Time PCR system (Roche) as follows ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were run in a LightCycler® 480 real time-PCR system (Roche). Viral titers were obtained by plaque assay.
-
bioRxiv - Cell Biology 2022Quote: ... Polymerase Chain Reactions (PCRs) were performed with the Expand High Fidelity polymerase (Roche) and a TRIO-thermoblock (Biometra GmbH) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library enrichment was performed with the KAPA HotStart PCR kit (Roche Diagnostics KK2502) in 50 μl of total reaction volume (10 μl 5X KAPA buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... ß-Actin (ACTB): hs01060665_g1 on a LC480 Real Time PCR (Roche, Madrid, Spain). ACTB expression was used as the endogenous reference control using the comparative cycle threshold method ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was PCR amplified with FastStart Taq DNA Polymerase (Roche Diagnostics, Mannheim, Germany) using GeneAmp 9700 PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... and real-time PCR was performed using SYBR Green I Master (Roche, #04707516001). The primers used for each transcript are listed in Supplementary Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... Libraries were constructed using the Kapa HIFI HotStart ReadyMix PCR Kit (KAPA Biosystems). Nucleic acid purification was performed using SPRI Select (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... Clone probes were PCR labelled with biotin-16-dUTP (from Roche Applied Science). Hybridization was performed over-night ...
-
bioRxiv - Genomics 2022Quote: ... We assessed the DNA library concentration through real-time PCR (Roche LightCycler 480) and SYBR Green chemistry (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was done with the SYBR Green I Master kit (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted with the High Pure PCR Template Preparation kit (Roche) from cells collected 72 hours after transfection.
-
bioRxiv - Neuroscience 2022Quote: ... Real-Time PCR analysis was conducted on a Light Cycler 480 system (Roche), and the data were processed and analyzed using the comparative ΔCT method (Livak and Schmittgen ...
-
bioRxiv - Pathology 2022Quote: ... on a commercially available real-time PCR platform (LightCycler 480, Roche Applied Sciences). The copy number estimate of MKPV DNA in each PCR test was calculated by plotting the real-time crossing point values from the MKPV PCR assay on a standard curve generated by testing log-fold dilutions of a known copy number positive control.
-
bioRxiv - Microbiology 2022Quote: ... directly as template for PCR using KAPA HiFi Hotstart ReadyMix (Roche, Basel, Switzerland). Sequencing libraries were prepared using the Oxford Nanopore 16S Barcoding Kit (SQK-RAB204 ...