Labshake search
Citations for Roche :
2151 - 2200 of 9230 citations for Monoisodecyl Phthalate 100 Ug Ml In Mtbe Unlabeled Mono 3 7 Dimethyl 1 Octyl Phthalate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 0.1% Triton X-100) with Protease Inhibitor Cocktail (27368400; Roche) and Phosphatase Inhibitor Cocktail (04906837001 ...
-
bioRxiv - Microbiology 2021Quote: ... 100 µl of protein G-coupled agarose bead resin (Roche) were washed (2 × CL buffer 4 ...
-
bioRxiv - Physiology 2021Quote: ... 100 mM ammonium bicarbonate and protease inhibitor (Roche, Penzberg, Germany). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5% Triton X-100) containing protease and phosphatase inhibitors (Roche). After sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5% Triton X-100) supplemented with PMSF and complete (Roche) protease inhibitors ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 100 µl of Tetra-Methyl Benzidine (TMB, Roche, Germany) solution was added to each well ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1% Triton X-100 1x EDTA-free protease inhibitors (Roche)) and stored at −20°C until use ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.25% Triton X-100 supplemented with cOmplete cocktail (11873580001, Roche), 20 mM N-ethylmaleimide (NEM ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1% Triton X-100 1x EDTA-free protease inhibitors (Roche)) and stored at −20°C until use ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cells were selected with 100 μM hygromycin (Roche, 10843555001) for about 3 weeks.
-
bioRxiv - Cancer Biology 2023Quote: ... we used 100 μl KAPA HiFi HotStart ReadyMix (Roche; 07958935001), 6 μl forward primer (5’ ACAC-GACGCTCTTCCGATCT 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 100 μM deferoxamine and 1X protease inhibitor (Roche), and centrifuged at 13,000g for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5% Triton X-100) freshly supplemented with protease inhibitors (Roche). Samples were denatured by the addition of NuPAGE Loading buffer (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... 100 mM sodium orthovanadate and complete protease inhibitor cocktail (Roche). HEK293T were lysed with commercially available mammalian protein extraction reagent buffer (Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% Triton X-100) freshly supplemented with protease inhibitors (Roche). Samples were denatured by the addition of NuPAGE loading buffer (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The pellet was washed in buffer A three times and then homogenized in 400 ul of buffer B (250 mM sucrose, 10 mM Tris HCl [pH 8.0], 10 mM MgCl2, 1 mM EGTA, 1X protease-inhibitor cocktail [11697498001, Roche], 0.1% Triton X-100, and 0.25% NP-40) for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2022Quote: ... and the cell pellet was re-suspended in 2 ml of triturating solution (containing 10 mg/ml bovine serum albumin [A7906, Sigma], 0.5 mg/ml trypsin inhibitor [10109886001, Roche], 0.02 mg/ml deoxyribonuclease).
-
bioRxiv - Developmental Biology 2020Quote: ... 0.1% SDS in distilled water with 1mg/ml Proteinase K (Roche, 20 mg/ml)) ...
-
bioRxiv - Immunology 2022Quote: ... and enzymatically digested with 0.227 mg/mL collagenase/dispase and 50U/mL DNase (Roche) for 45 minutes at 37C ...
-
bioRxiv - Immunology 2020Quote: ... Brains were then digested with 0.227mg/mL collagenase/dispase and 50U/mL DNase(Roche) for 1h at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The minced tissue was digested using 0.2 mg/mL collagenase/ 0.8U/mL dispase (Roche) and recombinant DNAse I (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Islets were prepared by injecting collagenase (10 ml of 0.23 mg/ml liberase; Roche Molecular Biochemicals ...
-
bioRxiv - Genetics 2024Quote: ... and digested with NB4 collagenase (12mg/ml) (SERVA) and Dispase II (100U/ml) (Roche) for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... The dissociation solution was then added to the brain (157.9µL DSM, 50µL papain solution (100units/mL) and 2.1µL Liberase (2.5mg/mL, Roche)) and dissociation took place for 30min at 30°C ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Immunology 2020Quote: ... DNase (10 μg/ml, Roche) and dispase II (1.5 mg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Collagenase (0.5 mg/ml, Roche), DNase (10 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... and 50ug/ml Liberase (Roche), minced and agitated at 37C with gentle agitation for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... and kanamycin (Roche, 20ug/ml), in glass-bottomed dishes (NEST Biotechnology) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg/mL insulin (Roche) and penicillin-streptomycin (100 U/mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10 μg/mL insulin (Roche), 200 μM indomethacin ...
-
bioRxiv - Developmental Biology 2020Quote: ... 15 µg/ml transferrin (Roche), 450 µM monothioglycerol (Sigma) ...
-
bioRxiv - Immunology 2022Quote: ... 10 μg/ml DNAse (Roche) and 2% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Dispase (Roche 049404942078001, 4mg/ml), and Collagenase (Worthington Biochem ...
-
bioRxiv - Immunology 2021Quote: ... 30 μg/ml DNase (Roche) in RPMI] added before 45 min incubation at 37°C on a shaking incubator ...
-
bioRxiv - Immunology 2019Quote: ... 0.4 mg/ml Dispase (Roche) and 0.025 mg/ml DNase I (Roche ...